ID: 1173648116

View in Genome Browser
Species Human (GRCh38)
Location 20:44646211-44646233
Sequence CTGTGTTCACACAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 6, 3: 47, 4: 425}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173648116_1173648125 23 Left 1173648116 20:44646211-44646233 CCTGCCTCCCTGTGTGAACACAG 0: 1
1: 0
2: 6
3: 47
4: 425
Right 1173648125 20:44646257-44646279 CCTTCCTCCTCCGAAGCAAAAGG 0: 1
1: 0
2: 2
3: 13
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173648116 Original CRISPR CTGTGTTCACACAGGGAGGC AGG (reversed) Intronic
900426621 1:2583230-2583252 CTGTGTCCTCACAGGGTGGAAGG - Intergenic
900664966 1:3809038-3809060 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901795582 1:11677477-11677499 CTGTGAGCACACAGGGACGGGGG + Intronic
901956974 1:12793412-12793434 CAGTGATCCCAGAGGGAGGCAGG - Exonic
901980370 1:13029548-13029570 CAGTGATCCCAGAGGGAGGCAGG - Intronic
902001717 1:13199383-13199405 CAGTGATCCCAGAGGGAGGCAGG + Intergenic
902020945 1:13345108-13345130 CAGTGATCCCAGAGGGAGGCAGG + Exonic
902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG + Intronic
902727545 1:18347165-18347187 CTGTGTTCAGAGAGGGAGGGAGG - Intronic
904873865 1:33638523-33638545 TCGTGTTTACACAAGGAGGCTGG - Intronic
906003774 1:42450296-42450318 CTGAAGTCACACAGGGATGCTGG + Intronic
907201327 1:52729150-52729172 CTGTTTTCACACATGGTGGCAGG + Intronic
909167687 1:72249179-72249201 CTGTGTTCTCACATGGTGGAAGG - Intronic
909198327 1:72655776-72655798 CTGTGTTCTCACATGGTGGAAGG - Intergenic
910976442 1:92911291-92911313 ATGTGTTCCCACAGGGTGGAAGG - Intronic
912386963 1:109275785-109275807 CTGTCCTCCCACAGGGAGGAAGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
914077492 1:144369066-144369088 CTGTGTCCTCACATGGAGGAAGG + Intergenic
914101687 1:144597439-144597461 CTGTGTCCTCACATGGAGGAAGG - Intergenic
915733361 1:158069455-158069477 GTGTGTTCACACACAGAGACTGG + Intronic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
919794336 1:201312119-201312141 CTGCGTGCACACATGGAGGCAGG - Intronic
920010051 1:202860941-202860963 ATGTGATCTCAGAGGGAGGCGGG + Intergenic
920157238 1:203963881-203963903 CTGTGTTCTCTCAAAGAGGCTGG - Intergenic
920724986 1:208426668-208426690 CTGTGTCCTCACATGGAGGAAGG + Intergenic
922739925 1:228009036-228009058 CTTTGGCCACACAGGGAAGCGGG + Intronic
923435679 1:233965696-233965718 CTGTGTTCTCATCTGGAGGCTGG - Intronic
923476883 1:234342318-234342340 CTGTGTCCTCACATGGTGGCAGG - Intergenic
1062957182 10:1548029-1548051 CTGTTTTCCCTCTGGGAGGCTGG + Intronic
1064801746 10:19082999-19083021 CTGTGTTCTCACATGGTGGAAGG + Intronic
1065390638 10:25177121-25177143 CTGAATTCACTCAAGGAGGCTGG + Intronic
1067230109 10:44400116-44400138 CTGTGTTCACACTCGGGGACAGG - Intergenic
1070439689 10:76431387-76431409 CTGTCGTCACCCAGGGAAGCAGG - Intronic
1070610970 10:77932289-77932311 TTGTCTTCAGACAGTGAGGCAGG + Intergenic
1071787459 10:88917925-88917947 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1072619558 10:97070660-97070682 CTGTGTCCTCACACGGAGGAAGG - Intronic
1072716701 10:97757145-97757167 CTGTGTCCAGCCAAGGAGGCTGG + Intronic
1073758004 10:106601716-106601738 CTGTGGTCACACAGGGACACTGG + Intronic
1075222333 10:120596067-120596089 CTGTGTCCTCACATGGTGGCAGG + Intergenic
1075406775 10:122200558-122200580 CTGCGTTCACATGGGGAGGACGG + Intronic
1075406816 10:122200738-122200760 CCGTGTTCACATGGGGAGGACGG + Intronic
1075406973 10:122201503-122201525 CTGTGTTCATATGGGGAGGACGG + Intronic
1075560775 10:123466982-123467004 CTGTGTCCACCCAGTGAGGCTGG - Intergenic
1076023355 10:127092356-127092378 TGGTGGGCACACAGGGAGGCTGG - Intronic
1076299502 10:129414421-129414443 CTGAGTTCAAAAAGGGACGCAGG - Intergenic
1076342260 10:129757492-129757514 CTGTGTTCGCCGAGGAAGGCAGG + Intronic
1076526783 10:131117123-131117145 CTGTGTTCAGGGTGGGAGGCTGG + Intronic
1077594652 11:3521506-3521528 TTGTGTTCACTCAGGGATCCAGG + Intergenic
1078082638 11:8215483-8215505 CTGTGTACTCCCAGGGAGACTGG + Intergenic
1078715687 11:13836938-13836960 CTGAGTTCACACAGCCAGGTAGG - Intergenic
1078740038 11:14058167-14058189 CTGGGTTCAATCAGGAAGGCAGG + Intronic
1079369859 11:19842171-19842193 CTGCATTCACCCAGGGAAGCTGG + Intronic
1080222933 11:29927374-29927396 CTGTTTTCTCACATGGAGGCTGG - Intergenic
1081968762 11:47184939-47184961 CTGTGTTTGCTCTGGGAGGCCGG - Intronic
1083766171 11:64842633-64842655 CTTCGTCCAGACAGGGAGGCAGG - Intronic
1083767238 11:64847430-64847452 CTGAGGTCACACAGGGAGTGAGG - Intergenic
1083935039 11:65865631-65865653 CAGAGTTCCCACAGGGAGGGAGG + Intronic
1083966093 11:66044855-66044877 TTGGGTTCACACAGTGAGTCAGG + Intronic
1084231466 11:67756796-67756818 CTGTCTTCCCTCTGGGAGGCAGG + Intergenic
1084250495 11:67894770-67894792 TTGTGTTCACTCAGGGATCCAGG + Intergenic
1084322298 11:68380347-68380369 CTGTGTTGACTGAGGCAGGCTGG + Intronic
1084416231 11:69034315-69034337 GTGGGTACAGACAGGGAGGCAGG - Intergenic
1084601953 11:70151076-70151098 CTGGGGTCACACAGCAAGGCTGG - Intronic
1084822283 11:71700568-71700590 TTGTGTTCACTCAGGGATCCAGG - Intergenic
1085240527 11:75050398-75050420 CTGGGTTCACACTGGTAAGCTGG + Intergenic
1085319820 11:75567077-75567099 CTGTGACAACCCAGGGAGGCAGG + Intronic
1085818207 11:79763924-79763946 ATGTGTCCATACAGGGAGACTGG + Intergenic
1088252922 11:107877225-107877247 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1088823944 11:113477993-113478015 CTGTGTTCACACATGGTGGAAGG + Intergenic
1088913989 11:114213054-114213076 CTGTGGGCACACAGGGGGTCGGG - Intronic
1089169021 11:116499749-116499771 GTGTGTGCGCACAGGGAGGGAGG - Intergenic
1089700028 11:120239208-120239230 CTGTGTGCAGACAGGAGGGCAGG - Intronic
1089875654 11:121719228-121719250 CTGTATCCAAACAGGGAGGTGGG + Intergenic
1090643533 11:128749081-128749103 CTAGGTTCACACAGTGAGGGGGG - Intronic
1090788076 11:130068134-130068156 CTGTGTTCGCACATGGAGGAGGG + Intergenic
1091267029 11:134278579-134278601 TTGTGGTCATACAGGGTGGCTGG - Intronic
1091323882 11:134669882-134669904 CTGTGTGTGCACAGGGAGGGGGG + Intergenic
1091538513 12:1436727-1436749 ATGTGTTCACACGGGCATGCAGG + Intronic
1092420826 12:8330292-8330314 TTGTGTTCACTCAGGGATCCAGG + Intergenic
1094478559 12:30861654-30861676 CTGTGTTCTCACATGGCGGAAGG + Intergenic
1095547509 12:43388908-43388930 CTGTGTTCTCATATGGAGGAAGG + Intronic
1096038179 12:48491283-48491305 CTGTGTCCTCACATGGAGGAAGG + Intronic
1096072186 12:48781590-48781612 CAGTGTTCACACCTGGGGGCAGG - Intronic
1097996082 12:65888990-65889012 CTGTGTCCACACTAGGAGGAAGG + Intronic
1099925222 12:89008880-89008902 CTGTGTCCTCACATGGTGGCAGG + Intergenic
1101646012 12:106631587-106631609 CTGTGTTCACACATGGCAGAAGG - Intronic
1101695204 12:107119095-107119117 CTCTGTTCACATATGGAGGTGGG - Intergenic
1101734569 12:107453455-107453477 CTGTGTTCTCACATGGTGGAAGG - Intronic
1101743742 12:107522089-107522111 CTGTGTTCTCGCAGGGTGGTGGG + Intronic
1101860917 12:108481774-108481796 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1102803655 12:115760210-115760232 CTGTGATCACACAATGAGGTAGG + Intergenic
1104543569 12:129689436-129689458 TTGTGTTCACTTAGAGAGGCAGG - Intronic
1104544945 12:129702060-129702082 CTGTGATAACACAGGGTGTCAGG + Intronic
1104749686 12:131230301-131230323 CTGTGTACAGATAGGAAGGCAGG - Intergenic
1104753829 12:131256552-131256574 CTGGGTTCACTGAGGCAGGCGGG - Intergenic
1104977520 12:132558876-132558898 CTGGCAGCACACAGGGAGGCCGG - Intronic
1105203498 13:18199631-18199653 CTGTGTACAGACAGGTAGGTTGG + Intergenic
1105448744 13:20479861-20479883 CAGTGTTGAGACAGGGATGCTGG + Intronic
1105561454 13:21496296-21496318 CTGTGTGCACACAGAGAGAAAGG - Intronic
1106076970 13:26468591-26468613 CTCTGCTCACACAGGGAGGTAGG + Intergenic
1106114145 13:26802340-26802362 CCTTGTTCACCCAGGGACGCAGG - Intergenic
1106933478 13:34692535-34692557 CTGTGTCCTCACAAGGAGGCAGG + Intergenic
1107634102 13:42374598-42374620 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1108228910 13:48318008-48318030 CTGTCGTCAGACAGGGAGCCGGG + Intronic
1111292138 13:86184716-86184738 CTGTCTTCACCCAGGGCTGCAGG - Intergenic
1112415806 13:99202401-99202423 CTGGGATCACACAGTGAGCCAGG + Intronic
1113225448 13:108154414-108154436 CTGTGGGCCAACAGGGAGGCTGG - Intergenic
1113960916 13:114125758-114125780 CTGTGTTCACGCAGGAAAGGAGG - Intronic
1114339026 14:21723763-21723785 CTGTGCTGACACAGGGTTGCTGG + Intergenic
1114430998 14:22660473-22660495 CTGTGTTCTCACATGGCGGAAGG + Intergenic
1115143089 14:30196534-30196556 CTGTGTCCTCACATGGTGGCGGG - Intergenic
1117241791 14:53841261-53841283 ATGTGCACACACAAGGAGGCAGG - Intergenic
1117839456 14:59844045-59844067 CTGTATTCTCACAAAGAGGCAGG - Intronic
1117885568 14:60357934-60357956 CTGTATTCATACAGGCAGTCTGG + Intergenic
1119502276 14:75140033-75140055 CTGTGTTCTCACATGGAGGAAGG - Intronic
1121396993 14:93634327-93634349 CTTTCTTCACACAGTGAGGATGG - Intronic
1121427303 14:93861625-93861647 CTGTGTTCTCACATGGTGGAGGG - Intergenic
1121862247 14:97329447-97329469 CTGTGTCCTCACAGGGTGGAGGG + Intergenic
1122155704 14:99749163-99749185 CTGGGTGCACACCGGGAAGCGGG + Intronic
1122573873 14:102728390-102728412 CTGTGTACACCGAGGGCGGCAGG + Exonic
1122762260 14:104037948-104037970 TTCTGCTCACCCAGGGAGGCGGG - Intronic
1122785217 14:104160389-104160411 TTATGTCCACACAGGGAAGCTGG + Intronic
1122810674 14:104286267-104286289 CTGTGTCCTCACATGGAGGACGG + Intergenic
1123196022 14:106617460-106617482 CTGAGCACACACAGGGAAGCAGG + Intergenic
1123706780 15:22956528-22956550 CTGTGTTCTCCCAGGGATGCTGG - Intronic
1124193680 15:27601535-27601557 CTGCGGTCCCTCAGGGAGGCTGG + Intergenic
1124572585 15:30878666-30878688 CTGTGTCCACACATGGTGGAAGG - Intergenic
1124961999 15:34405634-34405656 CTGTGTTCCCACAGTTAGGTGGG + Intronic
1124978622 15:34551855-34551877 CTGTGTTCCCACAGTTAGGTGGG + Intronic
1125518862 15:40337447-40337469 CTGTGTAGACAGAGGGAGTCAGG + Intronic
1126541163 15:49825574-49825596 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1127726311 15:61753504-61753526 CTGTGTTCTCACAATGGGGCTGG + Intergenic
1127808894 15:62546102-62546124 CTGCTTTGACACAGTGAGGCTGG + Intronic
1129240797 15:74251041-74251063 CTGAGTTCATACAGGGAGTCAGG - Intronic
1129504332 15:76068643-76068665 CTGTGTCCTCACATGGAAGCAGG - Intronic
1129705993 15:77794933-77794955 CTGTCCTCACACTGGGAAGCTGG - Intronic
1130993532 15:88891178-88891200 CTGTGTTGACAAAGAGATGCAGG - Intronic
1131511869 15:93053653-93053675 CTGGGTTCACACAAGGCTGCTGG - Intronic
1132025257 15:98399648-98399670 CTGTGTGCTCACATGGAGGAAGG - Intergenic
1132119408 15:99163766-99163788 CTGTGTCCTCACAGGGTGGAAGG - Intronic
1133143802 16:3768661-3768683 CTGCTGTCACACAGGGATGCAGG + Intronic
1133359544 16:5163342-5163364 TTGTGTTCACTCAGGGATCCAGG + Intergenic
1133481918 16:6179083-6179105 CTGTCTTACCACAGGGAGGGTGG + Intronic
1134409619 16:13993141-13993163 CTGTGATCATCCAGGGAGGGAGG + Intergenic
1134761790 16:16720936-16720958 CTGTGCTCACCAAGGCAGGCCGG - Intergenic
1134847872 16:17456097-17456119 CTGTGTGCACAGAGTGAAGCTGG - Intronic
1134984268 16:18638234-18638256 CTGTGCTCACCAAGGCAGGCCGG + Intergenic
1135290947 16:21237559-21237581 CTGTGTCCTCACATGGAGGAAGG + Intronic
1135620267 16:23949852-23949874 CTGAGGTCTCACAGGTAGGCTGG + Intronic
1137836369 16:51596471-51596493 CTAGGATCACACAGTGAGGCAGG + Intergenic
1138085960 16:54134166-54134188 CTGTTTAAACACAGGGAGGGAGG + Intergenic
1140745698 16:77978313-77978335 ATCTGTAAACACAGGGAGGCAGG + Exonic
1140868298 16:79083379-79083401 CTGTGGTCACTCAGGGACCCAGG - Intronic
1141027446 16:80561545-80561567 TTGTGTTCACACTGGGATCCAGG - Intergenic
1141306692 16:82871256-82871278 ATGTGGTCAGACAGGGTGGCTGG + Intronic
1141563430 16:84885432-84885454 CCTGGTTCAGACAGGGAGGCCGG + Intronic
1141798569 16:86291610-86291632 CTGGGTTCACAGTGGGTGGCAGG - Intergenic
1141805906 16:86341343-86341365 CTGTGGACACACAGGGAGCGCGG + Intergenic
1141851883 16:86651965-86651987 GTGTGTACTCACAGGGTGGCTGG + Intergenic
1142275639 16:89117511-89117533 CTGTCTACACCCAGGGAGTCAGG + Intronic
1142680709 17:1546608-1546630 CTGTACCCACACATGGAGGCTGG + Intronic
1142887546 17:2922192-2922214 CAGTGTCCTCACAGGGAGGAAGG + Intronic
1143048886 17:4105913-4105935 CAGTGTTCCCACAGAGAAGCTGG + Intronic
1143057685 17:4174560-4174582 CTGTGTACACACAAGCATGCAGG + Intronic
1143250915 17:5522396-5522418 CTGTGTCCTCACAGGGTGGAAGG - Intronic
1143877794 17:10005546-10005568 CTGTGTTCATGCAGGAAGGTGGG + Intronic
1144342806 17:14324155-14324177 CTGTTTTTACACATGGAGACAGG + Intronic
1146004981 17:29155419-29155441 CAGGGTCCACACAGGGCGGCAGG - Intronic
1146296315 17:31653400-31653422 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1146626411 17:34438650-34438672 CTGTGATCTCACAGGGGGACAGG + Intergenic
1147325102 17:39666266-39666288 CTGAGTTCCCAAAGGGAGGGTGG + Exonic
1147342915 17:39765646-39765668 CTGTGTTCACAGGGGTAGCCAGG - Exonic
1147554004 17:41464759-41464781 CTGTGTTCATCCTGGGAGGAGGG + Intronic
1147940215 17:44041481-44041503 CTGTGCTCACATAGGGAGCCAGG + Intronic
1147973047 17:44230152-44230174 CTCAGGTCACGCAGGGAGGCAGG - Intergenic
1148441426 17:47713564-47713586 CTCTGTGGAGACAGGGAGGCAGG + Intergenic
1148470349 17:47889292-47889314 TTGTTTTCAGACAGGGAGACAGG + Intergenic
1148909772 17:50935198-50935220 CTGTTTTCACAGTGGGAAGCAGG - Intergenic
1149619654 17:58033884-58033906 CTGTGTTCTCACATGGTGGGTGG - Intergenic
1149957675 17:61070743-61070765 CTGTATTTACACAGGCAGCCTGG + Intronic
1150841102 17:68606395-68606417 GTGTGTTCATACATGGAGGTGGG + Intergenic
1151375884 17:73688818-73688840 CAGTGATCACTCAGGGTGGCTGG + Intergenic
1152346377 17:79754855-79754877 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1152810300 17:82378691-82378713 CTGTGTTCTGACTTGGAGGCGGG - Intergenic
1153046171 18:857314-857336 CTGTGGACACACAGGAATGCTGG + Intergenic
1154193688 18:12250922-12250944 GTTTTTTCAAACAGGGAGGCTGG + Intergenic
1159160903 18:64642577-64642599 ATCTGTTCACACAGTGAGGAGGG + Intergenic
1160149584 18:76388882-76388904 CTCTCTTCACACTGGGCGGCAGG + Intronic
1160156595 18:76438854-76438876 CTGTGCTCCCACAGGCAGGCTGG + Intronic
1160411338 18:78677350-78677372 CTGTGTCCACACAGAGGTGCAGG + Intergenic
1160838696 19:1136764-1136786 CTGCTTTCAGGCAGGGAGGCAGG - Intronic
1162184072 19:8891157-8891179 ATGGGTCCAGACAGGGAGGCTGG + Exonic
1162965965 19:14156241-14156263 CAGTGCTCACTGAGGGAGGCAGG - Intronic
1162997150 19:14343414-14343436 CTGTGTTCACAGAGCCAGCCAGG + Intergenic
1163625692 19:18388272-18388294 CTGTCTTCCCACAGTGCGGCTGG + Exonic
1164979601 19:32603900-32603922 CTGTGTTCACACTGTGAGGATGG + Intronic
1166214504 19:41326383-41326405 CTGTGTTCCCACATGTAGGCTGG - Intronic
1167289093 19:48614855-48614877 CTGTGTTTACACAAGGGGCCGGG - Intergenic
1167723980 19:51198815-51198837 CTCTGCTCACACAGGGATCCCGG + Intergenic
1167725616 19:51211068-51211090 CTCTGCTCACACAGGAAGCCCGG + Intergenic
1168469590 19:56629548-56629570 CTGTGCCCACACATGGAGGAAGG - Intergenic
1168476259 19:56677569-56677591 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
1168593415 19:57654840-57654862 CTATATTCCCACAGGGGGGCTGG + Intergenic
924980815 2:219454-219476 CTGTGTCCTCACAAGGAGGAAGG - Intronic
924996812 2:368819-368841 CTGTGTCCTCACATGGAGGGAGG + Intergenic
925016879 2:534697-534719 CTGTGTTCTCACATGGTGGAAGG + Intergenic
925578874 2:5389670-5389692 GTCTGTTTACACAGGGAGGTAGG - Intergenic
926140850 2:10367014-10367036 CTGAGATCCCACAGTGAGGCTGG + Intronic
927211264 2:20640551-20640573 CTGTGTTCTCACAGCCTGGCTGG - Intronic
928365179 2:30694995-30695017 CTGTGCACACACACAGAGGCAGG + Intergenic
928844130 2:35648713-35648735 CTGTATTCTCACAGGGAGGAAGG + Intergenic
930218240 2:48719320-48719342 CTGTGTTGAAATAGGGAGTCTGG - Intronic
930438726 2:51379588-51379610 CTATGTGCACCCAGGTAGGCTGG + Intergenic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
930557677 2:52919812-52919834 CTGTGTTCTCACAGAGTGGAAGG - Intergenic
930901520 2:56512490-56512512 TTTTGTTTACTCAGGGAGGCTGG - Intergenic
931831453 2:66055920-66055942 CTGTGTTCTCACATGGAAGAAGG - Intergenic
932462740 2:71893843-71893865 CTGTGTTCCGCCAGGGAGGGAGG + Intergenic
932629972 2:73332560-73332582 CTGTGTCTACACAGGCAGGGTGG + Intergenic
932702454 2:74001138-74001160 CTGTGTTCCCAGGGGGAGGCAGG + Intronic
932820342 2:74894469-74894491 GTGTGTTGGCACAGGGAGCCTGG + Intergenic
933979156 2:87536564-87536586 CTGTGTTCTCCCAGGGAGGGGGG - Intergenic
934853978 2:97717829-97717851 CTGCCTTTACCCAGGGAGGCTGG + Intronic
935180621 2:100687371-100687393 CTGTGTCCTCACATGGAGGAAGG - Intergenic
935261920 2:101362974-101362996 CTGTGCTCACTCATCGAGGCTGG + Intronic
935763642 2:106343609-106343631 CTGTGTGCTCCCAGGGAGGCTGG - Intergenic
936078200 2:109415162-109415184 CTGTGTTCCCTCTGGGAGTCTGG - Intronic
936314671 2:111414228-111414250 CTGTGTTCTCCCAGGGAGGGGGG + Intergenic
937068920 2:119046853-119046875 CTTTGTTCATAAAGGGATGCTGG + Intergenic
937934360 2:127230739-127230761 CTGTGTCCTCACAGGGCGGAAGG - Intergenic
938342905 2:130547301-130547323 CTGTGTGCCCAAAGGGAGTCAGG - Intronic
938346928 2:130573421-130573443 CTGTGTGCCCAAAGGGAGTCAGG + Intronic
938392732 2:130917636-130917658 CTGTGTTCACTGGGGGAGGGGGG - Intronic
939162159 2:138603622-138603644 CTGTGTTCTCACAGGGTTGAAGG + Intergenic
939620298 2:144410684-144410706 CTGTGTTCACAGTGGAAGACAGG + Intronic
940008358 2:149030397-149030419 CTGTGTCCACACATGGTGGAAGG + Intergenic
940235975 2:151511195-151511217 TTGTGTTCACTGAGGGAGCCAGG - Intronic
940771617 2:157844869-157844891 CTGTGTTCTCACATGGTGGAAGG - Intronic
941226721 2:162858658-162858680 CTTTGTTCACAGAGGGAGACAGG + Intergenic
941394311 2:164955567-164955589 CCCTGTTCTCTCAGGGAGGCGGG - Intergenic
942461089 2:176169429-176169451 CTGAGTTCAGACCAGGAGGCTGG - Exonic
942736026 2:179113950-179113972 CTGTGATTACACAGGGTGGGGGG + Intronic
946203898 2:218089664-218089686 CTGTGCTCACAGAGGAAGGAGGG - Intronic
946489001 2:220129712-220129734 CTGTTCCCACACAGGGAGGGAGG - Intergenic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
947708085 2:232292673-232292695 CTGAGGTCACACAGGAGGGCAGG - Intronic
948496951 2:238356715-238356737 CTGTTTGCAGACTGGGAGGCTGG + Intronic
948641167 2:239376824-239376846 CTGTGCTTACTCAGGGAGTCTGG - Intronic
948771605 2:240253985-240254007 CTGGCTTCCCAGAGGGAGGCAGG + Intergenic
948846995 2:240687936-240687958 CTGTGAGGACACAGGGAGCCTGG + Intergenic
1168753373 20:298806-298828 GTGTGTTCACCCTGGCAGGCAGG - Exonic
1169877159 20:10310732-10310754 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1172194316 20:33081724-33081746 CAGAGTTCACATCGGGAGGCTGG + Intronic
1172226629 20:33309726-33309748 CTGGGTTTCCACAAGGAGGCTGG - Exonic
1172240174 20:33407964-33407986 CTGTGAGCACACAGGCAGCCCGG - Exonic
1172288314 20:33757053-33757075 CTGAGGTCAATCAGGGAGGCAGG + Intronic
1172632766 20:36390349-36390371 CTGGAGTCACACAGAGAGGCAGG + Intronic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173317886 20:41961395-41961417 CTGTGGAGACACAGGGAGGCAGG - Intergenic
1173428131 20:42960349-42960371 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1173585176 20:44176911-44176933 CTGGAGTCACACATGGAGGCTGG - Intronic
1173648116 20:44646211-44646233 CTGTGTTCACACAGGGAGGCAGG - Intronic
1173813280 20:45969368-45969390 CTGAGTTCACACAGCTAGGGTGG + Intronic
1173839477 20:46148007-46148029 TGGTGGTCACACAGGCAGGCGGG - Intergenic
1173964361 20:47100626-47100648 CAGAGATCACACAGGAAGGCAGG - Intronic
1174650420 20:52120107-52120129 CTGTGTCCACACATGGTGGAAGG - Intronic
1174941221 20:54930737-54930759 TGTTGTCCACACAGGGAGGCTGG - Intergenic
1175247177 20:57589203-57589225 CTGAGGCCACACAGGGAGGCAGG + Intergenic
1175395559 20:58657472-58657494 CTGTGTTTACTCAGGAAGTCTGG - Intronic
1175494837 20:59406688-59406710 CTGTTGTCACACAGGGAGAGCGG - Intergenic
1175751266 20:61499579-61499601 CTGAGGTCACACAGGGAGGAGGG + Intronic
1175988814 20:62777463-62777485 CTGGGTTCGCACAGGGAGCCAGG + Intergenic
1177327935 21:19616674-19616696 CTGTGTCCTCACATGGTGGCAGG - Intergenic
1177842984 21:26255401-26255423 CTGTGTCCACACATGGTGGCAGG + Intergenic
1178422513 21:32453455-32453477 CTGTCTTCCCTCTGGGAGGCAGG - Exonic
1178497673 21:33101224-33101246 CTGTGTCCACAGAGGTGGGCAGG + Intergenic
1179000521 21:37453453-37453475 TTTTGTTCTCACAGTGAGGCAGG + Intronic
1179312992 21:40213358-40213380 CTATGTGTGCACAGGGAGGCAGG - Intronic
1179389604 21:40975698-40975720 CTGTGTTCTCACTGGAAAGCTGG + Intergenic
1179710619 21:43211083-43211105 CTCTGTTCACTCCGGGAGGCAGG + Intergenic
1179802877 21:43819743-43819765 CTGGGCCCACACAGGAAGGCCGG - Intergenic
1180102465 21:45595232-45595254 CTGTGGTCACCCAGGGAGGGAGG + Intergenic
1180191808 21:46168928-46168950 GTGTGGGCACACAGGCAGGCAGG - Intronic
1181364375 22:22363850-22363872 CTGTGTCCTCACAGGGAACCAGG + Intergenic
1181370852 22:22415646-22415668 CTGTGTCCTCACAGGAAAGCTGG + Intergenic
1181530595 22:23514900-23514922 CTGGGTTAAAACAGGAAGGCTGG + Intergenic
1181542447 22:23580528-23580550 CTGAGGTCACACAGGGAGGTGGG + Intergenic
1182483485 22:30625344-30625366 CTGTGTTCTCACATGGTGGAAGG + Intronic
1183007562 22:34916188-34916210 CTGTGTCCTCACAGGGTGGAAGG - Intergenic
1183376393 22:37467848-37467870 CTGTGGTCACACAGTGAGTTGGG - Intergenic
1183710794 22:39502184-39502206 GTGAGGTCACACACGGAGGCGGG + Intronic
1183952587 22:41359856-41359878 CTGTGTTCCCCCCGGCAGGCAGG + Exonic
1184022551 22:41830609-41830631 TTGTTCACACACAGGGAGGCTGG - Intergenic
1184039217 22:41933388-41933410 CTGTGTCCTCACAGGGAGGCTGG + Intergenic
1184249926 22:43254173-43254195 CTCTGGTCACACAGGCAGACAGG - Intronic
1184428678 22:44428371-44428393 CTGAGTTCACACAGCAAGACAGG + Intergenic
1184616048 22:45639531-45639553 CTGAGGTCACACAGCAAGGCAGG - Intergenic
1184659843 22:45960694-45960716 CTGTGATCAGCCAGGGAGGCGGG + Intronic
1185034123 22:48462382-48462404 GTGTGAACACTCAGGGAGGCGGG - Intergenic
1185221088 22:49629612-49629634 CTGGGTTGGAACAGGGAGGCTGG + Intronic
1185221098 22:49629644-49629666 CTGGGTTCAAACAGGGAGGCTGG + Intronic
1185221109 22:49629676-49629698 CTGGGTTGGAACAGGGAGGCTGG + Intronic
1185221119 22:49629708-49629730 CTGGGTTCAAACAGGGAGGCTGG + Intronic
1185221140 22:49629772-49629794 CTGGGTTGGAACAGGGAGGCTGG + Intronic
1185221151 22:49629804-49629826 CTGGGTTGGAACAGGGAGGCTGG + Intronic
1185379956 22:50503741-50503763 CTGGGTTTACCCCGGGAGGCTGG + Intronic
1185413545 22:50697922-50697944 CCGTGGTGACACAGGGAGCCCGG - Intergenic
953896626 3:46808219-46808241 CTGAGTACCCACAGGGAGGAGGG - Intronic
954797659 3:53169670-53169692 CATTGTTGAGACAGGGAGGCTGG + Intronic
955123160 3:56082309-56082331 CTGTGTTCTCACATGGTGGAAGG - Intronic
956594114 3:70947888-70947910 CTGTGTTCCTCCAGGGATGCTGG + Intergenic
957064791 3:75512844-75512866 TTGTGTTCACTCAGGGATCCAGG + Intergenic
957363361 3:79187924-79187946 CTGAGATCACACAGGGAGTTAGG - Intronic
957608265 3:82432419-82432441 CTGTGTTCTCACACGGAGAAAGG + Intergenic
959594151 3:108110912-108110934 CTGTGTCAAAACAGGGATGCTGG - Intergenic
960866313 3:122203258-122203280 CTGTGTTCATACAGATAGGAAGG - Intronic
961288557 3:125826553-125826575 TTGTGTTCACTCAGGGATCCAGG - Intergenic
961392091 3:126558255-126558277 CTGCATTCACACAGTGAGTCGGG + Intronic
961880082 3:130055755-130055777 CTGTCTTCCCTCTGGGAGGCAGG + Intergenic
961898501 3:130189492-130189514 TTGTGTTCACTCAGGGATCCAGG + Intergenic
962301237 3:134244925-134244947 CTGTGTTCTCACATGGTGGAAGG - Intronic
962814902 3:138988832-138988854 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
963071067 3:141305733-141305755 CTGTGTCCACACATGGGGGTGGG - Intergenic
963412107 3:144941908-144941930 CTGTGTCCTCACATGGTGGCTGG + Intergenic
963645471 3:147908376-147908398 CTGTGTTCTCACATGGTGGAAGG - Intergenic
964736243 3:159921604-159921626 CTGTGTCCACACATGGTGGAGGG + Intergenic
964832748 3:160903714-160903736 GTGTGTGCACACATGGAGGTGGG + Intronic
966532139 3:180992923-180992945 CTGTGTTCTCACAGGGTGGAAGG - Intergenic
966568964 3:181418582-181418604 CTGTGTCAACACAGAGAGGCTGG + Intergenic
966702959 3:182876664-182876686 CTGTGTCCACACATGGTGGAAGG + Intronic
967002943 3:185354267-185354289 CTCTGTTGACACAGAGAGGTAGG - Intronic
968943359 4:3650976-3650998 CTGTCTGCACGCAGGGATGCCGG - Intergenic
969009484 4:4049990-4050012 TTGTGTTCACTCAGGGATCCAGG + Intergenic
969128456 4:4972208-4972230 CTGTGTCCACACAGGGTGGAAGG - Intergenic
969299007 4:6286359-6286381 CTGTGTCCTCACAGGGTGGAAGG - Intronic
969323033 4:6424541-6424563 CTGTGGATACACAGGGAGGCCGG + Intronic
969366297 4:6696356-6696378 CTGAAGTCACACAGGGAGCCGGG - Intronic
969524488 4:7697253-7697275 CTGTGGTCACACCTGGCGGCAGG + Exonic
969744866 4:9062324-9062346 TTGTGTTCACTCAGGGATCCAGG - Intergenic
969804283 4:9594430-9594452 TTGTGTTCACTCAGGGATCCAGG - Intergenic
969924860 4:10576158-10576180 CTCTGTTCACTCAGTGAGGGAGG - Intronic
970272378 4:14360765-14360787 CTGTCTTCACACAGTGTGCCGGG + Intergenic
970550673 4:17177960-17177982 CTGTGTCCTCACATGGAGGAAGG + Intergenic
970813280 4:20122486-20122508 CTGTGTCAACACAGAGAGGGTGG - Intergenic
971081014 4:23211239-23211261 CAGTGTTCACACAGTGATGAAGG - Intergenic
971155296 4:24075262-24075284 CTGTGTTTTCACAGGGAGGAAGG - Intergenic
971235937 4:24842489-24842511 GTGGGTTGGCACAGGGAGGCTGG - Intronic
973792864 4:54394633-54394655 CACTGTTCAGAGAGGGAGGCAGG - Intergenic
976989243 4:91344197-91344219 ATGTGTTCTCACATGGAGGAAGG - Intronic
978488081 4:109278945-109278967 CTGTGTTCACACATGGTGGAAGG + Intronic
980614588 4:135202332-135202354 CTGTGTCCTCACATGGAGGAAGG - Intergenic
981038740 4:140199914-140199936 CTGTGTTCTCACATGGTGGAAGG + Intergenic
982103279 4:151989523-151989545 CTGTGTAACCACAGGGAAGCAGG - Intergenic
982709979 4:158748242-158748264 CTGTGTTCTCACATGGTGGAAGG - Intergenic
982727995 4:158925932-158925954 CTGTGTCCTCACAGGGTGGAAGG + Intronic
983477064 4:168226425-168226447 CTGTGTTCTCACATGGTGGAAGG - Intronic
983826526 4:172268789-172268811 CTGTGTTCTCACATGGAAGAGGG - Intronic
984215343 4:176905817-176905839 CCTTGTTCTCACAGGGAGGAAGG - Intergenic
984489026 4:180408838-180408860 CTGTGTTCTCACATGGTGGATGG - Intergenic
984575060 4:181438424-181438446 CTGTGATCTCACTGGGAAGCAGG + Intergenic
984578925 4:181487499-181487521 CTGTGTTCTCACATGGTGGAAGG + Intergenic
987937284 5:24482363-24482385 CAGTGTGAACACAGGAAGGCAGG + Intergenic
988973334 5:36491209-36491231 CTGTTTTCTTCCAGGGAGGCGGG + Intergenic
989734761 5:44690501-44690523 CTGTGTCCTCACATGGAGGAAGG + Intergenic
990091261 5:52052700-52052722 CTGTGTTCTCACATGGAAGGAGG + Intronic
995311890 5:110722555-110722577 CTGTGTGCTCTCATGGAGGCTGG + Intronic
996589409 5:125129285-125129307 CTGTGTTCTCACATGGTGGAAGG + Intergenic
996742248 5:126811208-126811230 CTGTGGCCTCACAGGGAGCCAGG + Intronic
996755161 5:126927503-126927525 CTGTGCCCATACAGGCAGGCAGG - Intronic
996965817 5:129306345-129306367 CTGATGTCACTCAGGGAGGCAGG + Intergenic
997353953 5:133250415-133250437 ATCTGTGCACTCAGGGAGGCTGG + Intronic
997476241 5:134144221-134144243 CTGTCCCCACACAGGGAAGCTGG + Intronic
998474554 5:142409366-142409388 CTGTGCTCACGGAGAGAGGCAGG + Intergenic
1000701467 5:164456616-164456638 CTGTGTTCGCACATGGTGGAAGG - Intergenic
1001055879 5:168449536-168449558 ATGTGAACACACAGGGAGACAGG - Intronic
1001652472 5:173325668-173325690 CTGTGTCTACACAGGCAGGGTGG - Intronic
1001699668 5:173697704-173697726 CTGTGATCACGCAGGGAGAAGGG + Intergenic
1002078500 5:176723844-176723866 CTGTGTACACAGAGAGGGGCTGG - Intergenic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002647727 5:180669282-180669304 CTGGGATCACTCAGAGAGGCAGG + Intergenic
1002803534 6:550104-550126 CTGTGCTCCCGCAGGCAGGCGGG + Intronic
1004424880 6:15500539-15500561 ATGTGTTGTCACATGGAGGCGGG - Intronic
1005462494 6:26082479-26082501 ATGTGTTGACACTGGGAGGAAGG + Intergenic
1006047344 6:31308693-31308715 CTGTGTCCCCGCGGGGAGGCAGG - Intronic
1006731541 6:36239795-36239817 CTTTGTTCACACTGGGATACCGG - Intergenic
1007285535 6:40744758-40744780 CTGTGTGCAGACAAGGAGGCTGG - Intergenic
1009028974 6:58034468-58034490 CTGTGTTCACAAAGGGTGAAGGG + Intergenic
1009204508 6:60785857-60785879 CTGTGTTCACAAAGGGTGAAGGG + Intergenic
1011074242 6:83421008-83421030 CTGTATGCAGACAGGGAGGGGGG + Intronic
1011868489 6:91862013-91862035 CTCTGTTCTCACAGAAAGGCTGG - Intergenic
1014406031 6:121052347-121052369 CTGTGTTCATGGAGGGAGACAGG - Intergenic
1016614340 6:146029030-146029052 CTGTGGTCACTGAGGAAGGCGGG - Intronic
1017877936 6:158538934-158538956 CTGTGGTCAGAGAGAGAGGCTGG + Intronic
1018953563 6:168393674-168393696 CTGTGTTCCCACACACAGGCTGG - Intergenic
1019209769 6:170395473-170395495 ATGTGTTCCCACAGGGAGGTGGG + Exonic
1019316417 7:388990-389012 CTGTGTCCGCCCAGGGAGCCGGG + Intergenic
1019492195 7:1320670-1320692 ATGTGTGCACACACGCAGGCGGG - Intergenic
1019643435 7:2116585-2116607 CTGTGTGTACACAGGGCTGCAGG + Intronic
1020315117 7:6900458-6900480 CTGTCTTCCCTCTGGGAGGCAGG + Intergenic
1020891242 7:13880440-13880462 CAGTGTCAACACAGGCAGGCAGG - Intergenic
1021402775 7:20228735-20228757 CTATGTTCACACAGAAAAGCAGG + Intergenic
1021468219 7:20969866-20969888 CTTTGTTCTCACATGGAGGAAGG - Intergenic
1021863658 7:24932598-24932620 CTGTGTGCTCACAGGGTGGAAGG - Intronic
1021903684 7:25312678-25312700 TTGTGTTCACAAAGAGAGGTAGG - Intergenic
1022102334 7:27175869-27175891 CTGGATTCACACTGGGAGGAAGG - Intronic
1022407195 7:30101482-30101504 CTGTGTCCTCACATGGAGGAAGG + Intronic
1022411355 7:30141004-30141026 CTGTGGTCACACAGGGAACAAGG - Intronic
1023484383 7:40668993-40669015 CTGAGACCACATAGGGAGGCTGG + Intronic
1024001048 7:45189570-45189592 CTCTGTTCACACAGAGAGGCCGG + Intergenic
1024565068 7:50673942-50673964 CTCTGTGGAAACAGGGAGGCTGG - Intronic
1026154436 7:67814838-67814860 CTTTGTTCTCACAGAGAGGGCGG - Intergenic
1028766770 7:94568802-94568824 CTGTGTCCACACATGGTGGAAGG - Intergenic
1028906519 7:96160560-96160582 CTGTGTCCTCACATGGAGGAAGG + Intronic
1029068447 7:97875509-97875531 TTGTGTTCACTCAGGGATCCAGG + Intergenic
1029400575 7:100342869-100342891 CTGGGTTCACACTGGGAACCCGG + Intronic
1030013593 7:105196188-105196210 CTTTGTTCACATAGATAGGCAGG + Intronic
1030108876 7:106009616-106009638 CTGTGCTCCCGCAGGGAGGAGGG + Intronic
1030427194 7:109393488-109393510 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
1031572001 7:123370509-123370531 ATGTGATGACACAGGTAGGCTGG + Intergenic
1031967340 7:128036328-128036350 CTGTGATCCCATAGTGAGGCTGG + Intronic
1031976969 7:128100340-128100362 CTGTTATCACCCAGGGAGGAGGG + Intergenic
1034948457 7:155279903-155279925 CGGTATTCACACAGAGATGCAGG + Intergenic
1035129972 7:156642535-156642557 CGGTATTCACACAGAGATGCAGG - Intronic
1035399223 7:158553919-158553941 GTGTGTTTAGACAGGGAGGGTGG - Intronic
1035487134 7:159234800-159234822 CTGTCTTCATGCAGGGAGGTTGG + Intergenic
1036250769 8:7160665-7160687 TTGTGTTCACTCAGGGATCCAGG + Intergenic
1036366721 8:8126792-8126814 TTGTGTTCACTCAGGGATCCAGG - Intergenic
1036884165 8:12538870-12538892 TTGTGTTCACTCAGGGATCCAGG + Intergenic
1036935798 8:13001306-13001328 CTGGGTCCACTCAGTGAGGCGGG + Intronic
1037963479 8:23116618-23116640 CTGGGTACACACAGAGAGGGAGG - Intronic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1038017588 8:23528767-23528789 GTGACGTCACACAGGGAGGCGGG + Intergenic
1039795366 8:40908482-40908504 CTGTGTCCTCACATGGAGGGAGG + Intergenic
1040075691 8:43227033-43227055 CCATTTTCACTCAGGGAGGCTGG - Intergenic
1040889736 8:52304819-52304841 CTGTGTTCTCACATGGAGGAAGG + Intronic
1041716933 8:60941015-60941037 CTGTGTTCTCACATGGAAGAAGG + Intergenic
1042736744 8:71998176-71998198 CTGTGTTCTCACATGGTGGAAGG + Intronic
1044592662 8:93929384-93929406 CAGTGTTCACGCTGGAAGGCTGG - Intergenic
1047260309 8:123252136-123252158 CTGTGTTCAAACAGTAAGGAAGG - Intronic
1050544892 9:6701416-6701438 CTGCATTGACACTGGGAGGCTGG + Intergenic
1050810364 9:9738559-9738581 CTGTAATCACAGAAGGAGGCTGG - Intronic
1051117892 9:13718162-13718184 CTTTGTTCACACGGTGAGGAAGG - Intergenic
1051842742 9:21416588-21416610 GTTTGTGCACACAGGTAGGCAGG + Intronic
1052037314 9:23697017-23697039 CAGTCTTCCCCCAGGGAGGCAGG - Intronic
1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG + Intergenic
1053139619 9:35674434-35674456 CTCTGTTCACTCAGGGAAGGAGG + Intronic
1053196876 9:36126438-36126460 CTGTGGTTACACAGGGAGTCAGG + Intergenic
1053362973 9:37502661-37502683 CTGTGTTCCCACAGGCAGTGAGG + Intronic
1055134662 9:72814265-72814287 CTGTGATCACACAGGGCTCCAGG + Intronic
1056734921 9:89201356-89201378 CTGCCTTCACACAGGGAGGCTGG + Intergenic
1056808988 9:89749914-89749936 CTGAGGTCACACAGTGAGGATGG + Intergenic
1056885960 9:90444097-90444119 CTGTGGTCACACATGGAAGCTGG - Intergenic
1057288227 9:93777984-93778006 CCGTGTGCTCACAGTGAGGCGGG + Intergenic
1057588220 9:96348384-96348406 ATGTGTTCACTCAGGGATCCAGG - Intronic
1058669867 9:107351758-107351780 GTGTGCTCACAGAGGGAGGATGG + Intergenic
1058704014 9:107624108-107624130 GTGTGTTGACATTGGGAGGCAGG - Intergenic
1059726285 9:117011391-117011413 CTGTGTTCTCACATGGTGGAAGG - Intronic
1060529830 9:124341666-124341688 CTGTGGAGAGACAGGGAGGCAGG - Intronic
1060536134 9:124389596-124389618 CTGTGGAGAGACAGGGAGGCAGG + Intronic
1061249763 9:129419926-129419948 CTGGGTTAAAACAGGAAGGCTGG - Intergenic
1061272709 9:129552564-129552586 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1061499488 9:130993792-130993814 CTGTGCTCAGACAGGGTCGCCGG - Intergenic
1062120429 9:134831151-134831173 CTGTGTCCACCCAGGGAGGCTGG - Intronic
1062232001 9:135486971-135486993 CTGTCATCAGACAGGGAGCCGGG - Exonic
1185592709 X:1288141-1288163 ATGATTTCACAAAGGGAGGCAGG + Intronic
1185842601 X:3406530-3406552 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1185877422 X:3712644-3712666 CTCTGGGCACACAGGGAGGCTGG + Intronic
1185938513 X:4286008-4286030 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1186027017 X:5324277-5324299 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1186442746 X:9600301-9600323 CTGTGTTCTCACATGGTGGAAGG + Intronic
1187533569 X:20117379-20117401 CTGTGTTCACACATTGAGTGAGG - Intergenic
1189227609 X:39426586-39426608 CTTTGAGCACACAGGGAGCCAGG - Intergenic
1189304226 X:39974515-39974537 CTGTTGTCACCCAGAGAGGCAGG - Intergenic
1192176406 X:68888641-68888663 ATGTGGTCAGAGAGGGAGGCAGG + Intergenic
1194525747 X:94975637-94975659 CTGTGTTCTAACAGAGAGGTTGG + Intergenic
1195386152 X:104315039-104315061 CTGTATTCACACAGAGAGAAGGG - Intergenic
1197063796 X:122214848-122214870 CTGTGTTCTCACATGGTGGAAGG + Intergenic
1197749723 X:129956396-129956418 CTGAGCTCACACAGGGAGTTAGG - Intergenic