ID: 1173649053

View in Genome Browser
Species Human (GRCh38)
Location 20:44651559-44651581
Sequence GCCCAAAGTGAGCGCGCGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 31}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173649053_1173649059 -2 Left 1173649053 20:44651559-44651581 CCCCGCGCGCGCTCACTTTGGGC 0: 1
1: 0
2: 0
3: 6
4: 31
Right 1173649059 20:44651580-44651602 GCTTGTCGAAGGCGGGCGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 34
1173649053_1173649063 23 Left 1173649053 20:44651559-44651581 CCCCGCGCGCGCTCACTTTGGGC 0: 1
1: 0
2: 0
3: 6
4: 31
Right 1173649063 20:44651605-44651627 CATGGTGCCCTCGTGCGCCCCGG 0: 1
1: 0
2: 1
3: 6
4: 91
1173649053_1173649057 -10 Left 1173649053 20:44651559-44651581 CCCCGCGCGCGCTCACTTTGGGC 0: 1
1: 0
2: 0
3: 6
4: 31
Right 1173649057 20:44651572-44651594 CACTTTGGGCTTGTCGAAGGCGG 0: 1
1: 0
2: 0
3: 5
4: 79
1173649053_1173649060 -1 Left 1173649053 20:44651559-44651581 CCCCGCGCGCGCTCACTTTGGGC 0: 1
1: 0
2: 0
3: 6
4: 31
Right 1173649060 20:44651581-44651603 CTTGTCGAAGGCGGGCGTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 14
1173649053_1173649061 5 Left 1173649053 20:44651559-44651581 CCCCGCGCGCGCTCACTTTGGGC 0: 1
1: 0
2: 0
3: 6
4: 31
Right 1173649061 20:44651587-44651609 GAAGGCGGGCGTCTGGGCCATGG 0: 1
1: 0
2: 0
3: 12
4: 207
1173649053_1173649058 -9 Left 1173649053 20:44651559-44651581 CCCCGCGCGCGCTCACTTTGGGC 0: 1
1: 0
2: 0
3: 6
4: 31
Right 1173649058 20:44651573-44651595 ACTTTGGGCTTGTCGAAGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173649053 Original CRISPR GCCCAAAGTGAGCGCGCGCG GGG (reversed) Exonic
903389484 1:22953864-22953886 GCCCGACGTGCGCGCGCGCCTGG - Exonic
1076116916 10:127907303-127907325 CCCCGAGGTGAGCGCGCGTGCGG + Exonic
1077090891 11:777727-777749 GCGCAGTCTGAGCGCGCGCGGGG + Intronic
1083300663 11:61738201-61738223 GCCCAAAGTGAGCCCCCACCTGG + Exonic
1121308704 14:92923399-92923421 GGGCAAGGTGAGCGAGCGCGGGG + Exonic
1130517790 15:84639524-84639546 GCCCAAAGTGAACTCCCACGTGG + Exonic
1132719729 16:1309767-1309789 GCCCGAGGTGAGCGCGTGCGGGG + Intronic
1141068475 16:80932558-80932580 GCCCGGCGTGTGCGCGCGCGCGG - Intergenic
1142474700 17:181813-181835 GCCGCGAGTGTGCGCGCGCGGGG - Intergenic
1144519564 17:15944979-15945001 GCCCAAAGTTCGCGCCCGCGCGG - Exonic
1148556606 17:48582261-48582283 GCCCAGAGGGGGCGCGGGCGAGG + Intronic
1148591064 17:48817100-48817122 ACCCAAAGTTAGGGCGAGCGCGG - Exonic
1152815217 17:82403921-82403943 GGACAAGGTGAGCGCGCCCGTGG - Exonic
1153964211 18:10165981-10166003 GCCCAAGGTGAATGCGCGCAGGG + Intergenic
1154148220 18:11884504-11884526 GCCCAAAGTGAGTGAGTGTGAGG + Exonic
1156275740 18:35581565-35581587 GCCCCAAGTGAGCGGGCAGGCGG + Intronic
1161357596 19:3827563-3827585 GCCCAACGGGAGCCCGCGCGGGG - Exonic
1163635774 19:18436716-18436738 GGCCAACCAGAGCGCGCGCGCGG - Exonic
1167251103 19:48398851-48398873 GCCCAAGGTGCGCGCGACCGGGG + Exonic
1167495811 19:49818247-49818269 GCCCGACGCGAGCGCGCGCGCGG + Intergenic
927794155 2:26033884-26033906 GGCCACAGGGAGCGCGCCCGCGG + Intergenic
932245176 2:70190765-70190787 ACCGGAAGTGAGCGCTCGCGCGG - Intronic
946362850 2:219229444-219229466 GCCCTAAGTGAGCTCGCGGCGGG - Intronic
1169191307 20:3660613-3660635 GGACAACGTGAGCGCGCGCGTGG - Exonic
1170629946 20:18057519-18057541 ATCCCAGGTGAGCGCGCGCGGGG - Exonic
1172661923 20:36574050-36574072 GACCTGAGTGAGCGCGCGGGGGG + Intronic
1173649053 20:44651559-44651581 GCCCAAAGTGAGCGCGCGCGGGG - Exonic
1183504739 22:38202717-38202739 GGCCCCAGGGAGCGCGCGCGCGG - Intronic
949970363 3:9398052-9398074 ACCCAAGGAGAGCGAGCGCGGGG - Intronic
950131810 3:10552403-10552425 GCCCAAAGTGAGTGCTGGCCTGG + Intronic
993519456 5:88883233-88883255 GCGCGAGGGGAGCGCGCGCGAGG + Intronic
1004144426 6:13051664-13051686 GCCCAAAGTGACCTCCCTCGAGG + Intronic
1031468531 7:122143481-122143503 GCCCATTGTGAGCGCTCGCGCGG - Intronic
1034349156 7:150405311-150405333 GCGCCATGTGAGTGCGCGCGGGG + Intronic
1041792745 8:61714734-61714756 GCCCTAAGTGAGCAGGGGCGGGG - Intergenic
1042743289 8:72075447-72075469 GCCCCAGGTGCCCGCGCGCGTGG - Exonic
1190862633 X:54358646-54358668 GACCGCAGTGCGCGCGCGCGGGG + Intergenic
1201575320 Y:15456171-15456193 GCCCTGAGTGCGCGTGCGCGGGG - Intergenic