ID: 1173649053

View in Genome Browser
Species Human (GRCh38)
Location 20:44651559-44651581
Sequence GCCCAAAGTGAGCGCGCGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 31}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173649053_1173649058 -9 Left 1173649053 20:44651559-44651581 CCCCGCGCGCGCTCACTTTGGGC 0: 1
1: 0
2: 0
3: 6
4: 31
Right 1173649058 20:44651573-44651595 ACTTTGGGCTTGTCGAAGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1173649053_1173649057 -10 Left 1173649053 20:44651559-44651581 CCCCGCGCGCGCTCACTTTGGGC 0: 1
1: 0
2: 0
3: 6
4: 31
Right 1173649057 20:44651572-44651594 CACTTTGGGCTTGTCGAAGGCGG 0: 1
1: 0
2: 0
3: 5
4: 79
1173649053_1173649059 -2 Left 1173649053 20:44651559-44651581 CCCCGCGCGCGCTCACTTTGGGC 0: 1
1: 0
2: 0
3: 6
4: 31
Right 1173649059 20:44651580-44651602 GCTTGTCGAAGGCGGGCGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 34
1173649053_1173649061 5 Left 1173649053 20:44651559-44651581 CCCCGCGCGCGCTCACTTTGGGC 0: 1
1: 0
2: 0
3: 6
4: 31
Right 1173649061 20:44651587-44651609 GAAGGCGGGCGTCTGGGCCATGG 0: 1
1: 0
2: 0
3: 12
4: 207
1173649053_1173649060 -1 Left 1173649053 20:44651559-44651581 CCCCGCGCGCGCTCACTTTGGGC 0: 1
1: 0
2: 0
3: 6
4: 31
Right 1173649060 20:44651581-44651603 CTTGTCGAAGGCGGGCGTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 14
1173649053_1173649063 23 Left 1173649053 20:44651559-44651581 CCCCGCGCGCGCTCACTTTGGGC 0: 1
1: 0
2: 0
3: 6
4: 31
Right 1173649063 20:44651605-44651627 CATGGTGCCCTCGTGCGCCCCGG 0: 1
1: 0
2: 1
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173649053 Original CRISPR GCCCAAAGTGAGCGCGCGCG GGG (reversed) Exonic