ID: 1173649058

View in Genome Browser
Species Human (GRCh38)
Location 20:44651573-44651595
Sequence ACTTTGGGCTTGTCGAAGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 98}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173649039_1173649058 20 Left 1173649039 20:44651530-44651552 CCCAGGCGCCGGACCCCCGTCCC 0: 1
1: 0
2: 1
3: 13
4: 144
Right 1173649058 20:44651573-44651595 ACTTTGGGCTTGTCGAAGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1173649054_1173649058 -10 Left 1173649054 20:44651560-44651582 CCCGCGCGCGCTCACTTTGGGCT 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1173649058 20:44651573-44651595 ACTTTGGGCTTGTCGAAGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1173649037_1173649058 30 Left 1173649037 20:44651520-44651542 CCTCGGGCCGCCCAGGCGCCGGA 0: 1
1: 0
2: 0
3: 21
4: 163
Right 1173649058 20:44651573-44651595 ACTTTGGGCTTGTCGAAGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1173649044_1173649058 6 Left 1173649044 20:44651544-44651566 CCCCGTCCCCGGAGCCCCCGCGC 0: 1
1: 0
2: 5
3: 59
4: 482
Right 1173649058 20:44651573-44651595 ACTTTGGGCTTGTCGAAGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1173649045_1173649058 5 Left 1173649045 20:44651545-44651567 CCCGTCCCCGGAGCCCCCGCGCG 0: 1
1: 0
2: 1
3: 24
4: 284
Right 1173649058 20:44651573-44651595 ACTTTGGGCTTGTCGAAGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1173649046_1173649058 4 Left 1173649046 20:44651546-44651568 CCGTCCCCGGAGCCCCCGCGCGC 0: 1
1: 0
2: 2
3: 43
4: 360
Right 1173649058 20:44651573-44651595 ACTTTGGGCTTGTCGAAGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1173649040_1173649058 19 Left 1173649040 20:44651531-44651553 CCAGGCGCCGGACCCCCGTCCCC 0: 1
1: 0
2: 3
3: 28
4: 351
Right 1173649058 20:44651573-44651595 ACTTTGGGCTTGTCGAAGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1173649049_1173649058 -2 Left 1173649049 20:44651552-44651574 CCGGAGCCCCCGCGCGCGCTCAC 0: 1
1: 0
2: 1
3: 15
4: 239
Right 1173649058 20:44651573-44651595 ACTTTGGGCTTGTCGAAGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1173649053_1173649058 -9 Left 1173649053 20:44651559-44651581 CCCCGCGCGCGCTCACTTTGGGC 0: 1
1: 0
2: 0
3: 6
4: 31
Right 1173649058 20:44651573-44651595 ACTTTGGGCTTGTCGAAGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1173649042_1173649058 12 Left 1173649042 20:44651538-44651560 CCGGACCCCCGTCCCCGGAGCCC 0: 1
1: 0
2: 7
3: 54
4: 624
Right 1173649058 20:44651573-44651595 ACTTTGGGCTTGTCGAAGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1173649043_1173649058 7 Left 1173649043 20:44651543-44651565 CCCCCGTCCCCGGAGCCCCCGCG 0: 1
1: 0
2: 5
3: 69
4: 481
Right 1173649058 20:44651573-44651595 ACTTTGGGCTTGTCGAAGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1173649051_1173649058 -8 Left 1173649051 20:44651558-44651580 CCCCCGCGCGCGCTCACTTTGGG 0: 1
1: 0
2: 0
3: 9
4: 51
Right 1173649058 20:44651573-44651595 ACTTTGGGCTTGTCGAAGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1173649038_1173649058 23 Left 1173649038 20:44651527-44651549 CCGCCCAGGCGCCGGACCCCCGT 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1173649058 20:44651573-44651595 ACTTTGGGCTTGTCGAAGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1173649047_1173649058 0 Left 1173649047 20:44651550-44651572 CCCCGGAGCCCCCGCGCGCGCTC 0: 1
1: 0
2: 1
3: 29
4: 324
Right 1173649058 20:44651573-44651595 ACTTTGGGCTTGTCGAAGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1173649048_1173649058 -1 Left 1173649048 20:44651551-44651573 CCCGGAGCCCCCGCGCGCGCTCA 0: 1
1: 0
2: 2
3: 15
4: 182
Right 1173649058 20:44651573-44651595 ACTTTGGGCTTGTCGAAGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173649058 Original CRISPR ACTTTGGGCTTGTCGAAGGC GGG Exonic