ID: 1173649061

View in Genome Browser
Species Human (GRCh38)
Location 20:44651587-44651609
Sequence GAAGGCGGGCGTCTGGGCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 207}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173649055_1173649061 3 Left 1173649055 20:44651561-44651583 CCGCGCGCGCTCACTTTGGGCTT 0: 1
1: 0
2: 0
3: 3
4: 32
Right 1173649061 20:44651587-44651609 GAAGGCGGGCGTCTGGGCCATGG 0: 1
1: 0
2: 0
3: 12
4: 207
1173649047_1173649061 14 Left 1173649047 20:44651550-44651572 CCCCGGAGCCCCCGCGCGCGCTC 0: 1
1: 0
2: 1
3: 29
4: 324
Right 1173649061 20:44651587-44651609 GAAGGCGGGCGTCTGGGCCATGG 0: 1
1: 0
2: 0
3: 12
4: 207
1173649043_1173649061 21 Left 1173649043 20:44651543-44651565 CCCCCGTCCCCGGAGCCCCCGCG 0: 1
1: 0
2: 5
3: 69
4: 481
Right 1173649061 20:44651587-44651609 GAAGGCGGGCGTCTGGGCCATGG 0: 1
1: 0
2: 0
3: 12
4: 207
1173649048_1173649061 13 Left 1173649048 20:44651551-44651573 CCCGGAGCCCCCGCGCGCGCTCA 0: 1
1: 0
2: 2
3: 15
4: 182
Right 1173649061 20:44651587-44651609 GAAGGCGGGCGTCTGGGCCATGG 0: 1
1: 0
2: 0
3: 12
4: 207
1173649046_1173649061 18 Left 1173649046 20:44651546-44651568 CCGTCCCCGGAGCCCCCGCGCGC 0: 1
1: 0
2: 2
3: 43
4: 360
Right 1173649061 20:44651587-44651609 GAAGGCGGGCGTCTGGGCCATGG 0: 1
1: 0
2: 0
3: 12
4: 207
1173649045_1173649061 19 Left 1173649045 20:44651545-44651567 CCCGTCCCCGGAGCCCCCGCGCG 0: 1
1: 0
2: 1
3: 24
4: 284
Right 1173649061 20:44651587-44651609 GAAGGCGGGCGTCTGGGCCATGG 0: 1
1: 0
2: 0
3: 12
4: 207
1173649054_1173649061 4 Left 1173649054 20:44651560-44651582 CCCGCGCGCGCTCACTTTGGGCT 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1173649061 20:44651587-44651609 GAAGGCGGGCGTCTGGGCCATGG 0: 1
1: 0
2: 0
3: 12
4: 207
1173649053_1173649061 5 Left 1173649053 20:44651559-44651581 CCCCGCGCGCGCTCACTTTGGGC 0: 1
1: 0
2: 0
3: 6
4: 31
Right 1173649061 20:44651587-44651609 GAAGGCGGGCGTCTGGGCCATGG 0: 1
1: 0
2: 0
3: 12
4: 207
1173649042_1173649061 26 Left 1173649042 20:44651538-44651560 CCGGACCCCCGTCCCCGGAGCCC 0: 1
1: 0
2: 7
3: 54
4: 624
Right 1173649061 20:44651587-44651609 GAAGGCGGGCGTCTGGGCCATGG 0: 1
1: 0
2: 0
3: 12
4: 207
1173649049_1173649061 12 Left 1173649049 20:44651552-44651574 CCGGAGCCCCCGCGCGCGCTCAC 0: 1
1: 0
2: 1
3: 15
4: 239
Right 1173649061 20:44651587-44651609 GAAGGCGGGCGTCTGGGCCATGG 0: 1
1: 0
2: 0
3: 12
4: 207
1173649044_1173649061 20 Left 1173649044 20:44651544-44651566 CCCCGTCCCCGGAGCCCCCGCGC 0: 1
1: 0
2: 5
3: 59
4: 482
Right 1173649061 20:44651587-44651609 GAAGGCGGGCGTCTGGGCCATGG 0: 1
1: 0
2: 0
3: 12
4: 207
1173649051_1173649061 6 Left 1173649051 20:44651558-44651580 CCCCCGCGCGCGCTCACTTTGGG 0: 1
1: 0
2: 0
3: 9
4: 51
Right 1173649061 20:44651587-44651609 GAAGGCGGGCGTCTGGGCCATGG 0: 1
1: 0
2: 0
3: 12
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173649061 Original CRISPR GAAGGCGGGCGTCTGGGCCA TGG Exonic