ID: 1173649063

View in Genome Browser
Species Human (GRCh38)
Location 20:44651605-44651627
Sequence CATGGTGCCCTCGTGCGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 91}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173649055_1173649063 21 Left 1173649055 20:44651561-44651583 CCGCGCGCGCTCACTTTGGGCTT 0: 1
1: 0
2: 0
3: 3
4: 32
Right 1173649063 20:44651605-44651627 CATGGTGCCCTCGTGCGCCCCGG 0: 1
1: 0
2: 1
3: 6
4: 91
1173649051_1173649063 24 Left 1173649051 20:44651558-44651580 CCCCCGCGCGCGCTCACTTTGGG 0: 1
1: 0
2: 0
3: 9
4: 51
Right 1173649063 20:44651605-44651627 CATGGTGCCCTCGTGCGCCCCGG 0: 1
1: 0
2: 1
3: 6
4: 91
1173649054_1173649063 22 Left 1173649054 20:44651560-44651582 CCCGCGCGCGCTCACTTTGGGCT 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1173649063 20:44651605-44651627 CATGGTGCCCTCGTGCGCCCCGG 0: 1
1: 0
2: 1
3: 6
4: 91
1173649053_1173649063 23 Left 1173649053 20:44651559-44651581 CCCCGCGCGCGCTCACTTTGGGC 0: 1
1: 0
2: 0
3: 6
4: 31
Right 1173649063 20:44651605-44651627 CATGGTGCCCTCGTGCGCCCCGG 0: 1
1: 0
2: 1
3: 6
4: 91
1173649049_1173649063 30 Left 1173649049 20:44651552-44651574 CCGGAGCCCCCGCGCGCGCTCAC 0: 1
1: 0
2: 1
3: 15
4: 239
Right 1173649063 20:44651605-44651627 CATGGTGCCCTCGTGCGCCCCGG 0: 1
1: 0
2: 1
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173649063 Original CRISPR CATGGTGCCCTCGTGCGCCC CGG Exonic