ID: 1173660429

View in Genome Browser
Species Human (GRCh38)
Location 20:44729465-44729487
Sequence CAAACTAAGGTTTCTGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173660429_1173660436 29 Left 1173660429 20:44729465-44729487 CCCCCTCCAGAAACCTTAGTTTG No data
Right 1173660436 20:44729517-44729539 ACCTTCACAGAGCCCCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173660429 Original CRISPR CAAACTAAGGTTTCTGGAGG GGG (reversed) Intergenic
No off target data available for this crispr