ID: 1173661238

View in Genome Browser
Species Human (GRCh38)
Location 20:44735369-44735391
Sequence ATGCCTGTCTTTATTAGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173661234_1173661238 30 Left 1173661234 20:44735316-44735338 CCTTAAAAAACATGTTGTACATA No data
Right 1173661238 20:44735369-44735391 ATGCCTGTCTTTATTAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173661238 Original CRISPR ATGCCTGTCTTTATTAGCTA GGG Intergenic
No off target data available for this crispr