ID: 1173663763

View in Genome Browser
Species Human (GRCh38)
Location 20:44751482-44751504
Sequence AAGTGGCCCCAGTGACATGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173663763_1173663770 15 Left 1173663763 20:44751482-44751504 CCACCATGTCACTGGGGCCACTT 0: 1
1: 0
2: 0
3: 10
4: 154
Right 1173663770 20:44751520-44751542 CCATGGGACGAGCTCTCTTCCGG 0: 1
1: 0
2: 0
3: 4
4: 68
1173663763_1173663768 -1 Left 1173663763 20:44751482-44751504 CCACCATGTCACTGGGGCCACTT 0: 1
1: 0
2: 0
3: 10
4: 154
Right 1173663768 20:44751504-44751526 TGGACACAGCAGAATGCCATGGG 0: 1
1: 0
2: 0
3: 21
4: 162
1173663763_1173663767 -2 Left 1173663763 20:44751482-44751504 CCACCATGTCACTGGGGCCACTT 0: 1
1: 0
2: 0
3: 10
4: 154
Right 1173663767 20:44751503-44751525 TTGGACACAGCAGAATGCCATGG 0: 1
1: 0
2: 2
3: 14
4: 177
1173663763_1173663771 16 Left 1173663763 20:44751482-44751504 CCACCATGTCACTGGGGCCACTT 0: 1
1: 0
2: 0
3: 10
4: 154
Right 1173663771 20:44751521-44751543 CATGGGACGAGCTCTCTTCCGGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173663763 Original CRISPR AAGTGGCCCCAGTGACATGG TGG (reversed) Exonic
900425244 1:2575342-2575364 AAGAGGCGCCAGTGTCCTGGGGG - Intergenic
900792228 1:4688141-4688163 CGGTGGCCCCAGTGAGACGGGGG + Intronic
901015147 1:6225053-6225075 CAGTGGCCCCGGTGACCTTGGGG - Exonic
902216976 1:14940462-14940484 AGCTGGCCCCCGTGCCATGGTGG - Intronic
902641711 1:17770801-17770823 AAGTGGCTCCACTGAGATTGTGG + Intronic
902763922 1:18602145-18602167 ACGGGGGCCCAGTGACCTGGGGG - Intergenic
904560794 1:31395907-31395929 ATGTGGTCCCAGCTACATGGAGG - Intergenic
906054818 1:42907294-42907316 AAGTGGCTATAGTGACAGGGAGG - Intergenic
909481084 1:76129484-76129506 AAATGGCCCCAGTGAGGTGAGGG + Intronic
916657300 1:166887541-166887563 AACTGGCCTCACTCACATGGAGG + Intergenic
919187194 1:194167582-194167604 GAGAGGCCTCAGAGACATGGTGG - Intergenic
919917610 1:202148518-202148540 AAGTGGGCCGAGTGATCTGGGGG - Exonic
920741200 1:208582777-208582799 ATGTCCCCCCAGTGACACGGGGG - Intergenic
923087823 1:230714481-230714503 AAGAGGCCACAGGGACATGCAGG + Intergenic
923148841 1:231216577-231216599 AAGTGGCCCCTGTGGCAGGCCGG + Exonic
924430735 1:243994476-243994498 CAGTGGCCACAGTGACATCTGGG - Intergenic
1066300588 10:34092111-34092133 AAGGGGCCCCAGAGACACTGGGG + Intergenic
1067528669 10:47054876-47054898 GAGTGGCCCCAGGCATATGGGGG - Intergenic
1067851603 10:49758433-49758455 AGGCGGCTCCAGTTACATGGAGG - Exonic
1070838831 10:79469108-79469130 AAATGGCCTCAGTCACAGGGAGG - Intergenic
1070850056 10:79556392-79556414 AAGTGGAGCCGGTGGCATGGGGG + Exonic
1071136408 10:82459103-82459125 CAGTGGCCCCAGTGACCTAAAGG - Intronic
1071921229 10:90352759-90352781 CCTTTGCCCCAGTGACATGGTGG + Intergenic
1074449903 10:113550743-113550765 TGGTGGCCACGGTGACATGGTGG - Intergenic
1076047716 10:127307949-127307971 AAGTGGCCCCTGTGGGCTGGTGG + Intronic
1077921626 11:6646298-6646320 CAGAGGCCCCAGGGACCTGGAGG - Intronic
1081758575 11:45561359-45561381 AATTGGGCCCAGGGAGATGGCGG + Intergenic
1083298789 11:61729422-61729444 AGGTGGTGCCAGTAACATGGTGG + Intronic
1084117453 11:67050429-67050451 AATTATCCCCAGTGATATGGGGG + Exonic
1084666711 11:70580345-70580367 AAATGGCCCCAGTGTCCAGGGGG + Intronic
1092985394 12:13840188-13840210 AGTTGGCCCCAGTGATATGGAGG - Intronic
1093181925 12:15976462-15976484 TCTAGGCCCCAGTGACATGGGGG + Intronic
1095225469 12:39672548-39672570 AGCTGCCCCCAGTGACAGGGTGG - Intronic
1096578833 12:52571460-52571482 AAGAGGCCCCAGAGTCATTGGGG + Intronic
1097265968 12:57745112-57745134 AAGTGGTCCCAAGGACTTGGGGG - Exonic
1099104908 12:78485726-78485748 AAGAGGCCTCAGAAACATGGTGG + Intergenic
1099840894 12:87965369-87965391 AATTTGCCCCAGTTACATGATGG + Intergenic
1103041837 12:117702200-117702222 ATGTTGGCCCAGTGACATTGGGG - Intronic
1104489700 12:129183278-129183300 AATAGGCCCCTGTGACATGAAGG - Intronic
1105060529 12:133146248-133146270 AAGTTGCCCCAGTGCAGTGGTGG - Intronic
1105842870 13:24270630-24270652 TAGTGGCTACAGTGACATTGCGG - Intronic
1106375345 13:29181324-29181346 ACCTGGCCACAGTGACATGAGGG + Intronic
1106548552 13:30751686-30751708 ATGTGGCCACACTGGCATGGGGG - Intronic
1113325564 13:109278018-109278040 AAGTGGCCCCAGTGGGTTTGGGG - Intergenic
1119217395 14:72879606-72879628 AAGTGCGCCCAGGGACAGGGTGG + Intronic
1119403731 14:74382302-74382324 AATTAGCCCCAGTTACTTGGGGG - Intergenic
1119512533 14:75222650-75222672 AAGGGGCACCAGTGACGGGGAGG - Intergenic
1121889939 14:97580537-97580559 AGGTGGCCCCAGTGAATAGGGGG - Intergenic
1127688072 15:61367989-61368011 AAGTTGCCATGGTGACATGGAGG + Intergenic
1132934112 16:2472391-2472413 AGGTGACCCCAGGGACATGGAGG + Exonic
1134593319 16:15475064-15475086 AAGTGGCCCCAGCACCAAGGGGG - Intronic
1135048995 16:19177253-19177275 AGGTGGCGCCATTCACATGGTGG + Intronic
1138414828 16:56865644-56865666 GAGAGGCCCCAGTGAAATAGTGG + Intronic
1140034682 16:71363325-71363347 AAGTGGCCCAGGTGACGTAGGGG + Intronic
1140852561 16:78948668-78948690 AAGTGGCTCCCCTGACATAGGGG - Intronic
1141284575 16:82659766-82659788 AAGTGGCCACCATGCCATGGTGG - Intronic
1141845913 16:86608887-86608909 AAGTTGCCTTAGTGACATGTTGG + Intergenic
1142066395 16:88065402-88065424 AGGTGGGCCCAGTGTCATCGCGG - Intronic
1142321661 16:89387073-89387095 AGAAGGCCCCAGTGACATGGAGG + Intronic
1143573298 17:7774985-7775007 AAGTGGCCACAGTGAGATGCTGG + Intronic
1144768884 17:17748072-17748094 GGGTGGCCCCAGAGTCATGGCGG + Intronic
1148087500 17:45003188-45003210 TGGTGGGCCCAGTGATATGGGGG + Intergenic
1152461461 17:80444493-80444515 CAGTGCCCCCACTGATATGGGGG - Intergenic
1152608974 17:81306430-81306452 ACGTGTCCCCAGTGCCCTGGTGG + Intergenic
1154314838 18:13296456-13296478 ATGAGGACCCAGGGACATGGTGG - Intronic
1156204515 18:34871610-34871632 AAGTGGCCTCGGTGGGATGGTGG - Intronic
1156984884 18:43338391-43338413 AATGGGCCCCAGTAAAATGGTGG - Intergenic
1157444953 18:47737722-47737744 AAGTGGCCCCAGAGGCCTTGTGG + Intergenic
1158415508 18:57246720-57246742 AAGTTGCCCCAGAGACAGGATGG - Intergenic
1159942735 18:74420959-74420981 AAGTTGCCCCAGAGACAACGCGG + Intergenic
1162475407 19:10896555-10896577 AAGAGGCCCCAGTGGACTGGTGG - Intronic
1167402924 19:49284917-49284939 ACCTGGCCCCAGGGAAATGGTGG + Intergenic
925073967 2:996140-996162 AGGTGGCCTGAGTGTCATGGAGG + Intronic
925163211 2:1701399-1701421 AGGCGGCCACAGTGACATGAAGG + Intronic
927293540 2:21427593-21427615 GAATGGCCCCAGTGATTTGGAGG - Intergenic
927968325 2:27286603-27286625 AAGTGCCCACAGTGAAGTGGAGG - Intronic
931101796 2:59010735-59010757 AGGTGGCCCCATTCACATTGAGG - Intergenic
931442944 2:62304242-62304264 AAGTGGCCCCTGCCAAATGGAGG - Intergenic
934053891 2:88235525-88235547 AAGTGGCTGCATTCACATGGTGG + Intergenic
935095006 2:99935864-99935886 CAGAGTCCCCAGCGACATGGAGG + Intronic
936015708 2:108957464-108957486 AAGTGGCCCCGGGCTCATGGAGG + Intronic
938230599 2:129655323-129655345 GAGTGACCCCAGAGACATTGTGG + Intergenic
947659033 2:231852994-231853016 TTGTGGTCCCAGTGCCATGGAGG + Intergenic
948036637 2:234863376-234863398 AAGCTGCACCTGTGACATGGGGG + Intergenic
1168940532 20:1707550-1707572 AACTGGCCACAGAGAAATGGTGG + Intergenic
1169084418 20:2817767-2817789 AAGTGGCCCACGTAACATTGAGG - Intronic
1170371957 20:15658811-15658833 AAGAGACCCCAGTGATATGTTGG + Intronic
1170700678 20:18700689-18700711 ACGTGGCGTCAGTGGCATGGTGG + Intronic
1172006103 20:31819981-31820003 AAGTGGCCCCAGAGACTCAGTGG + Intronic
1173663763 20:44751482-44751504 AAGTGGCCCCAGTGACATGGTGG - Exonic
1175336037 20:58197042-58197064 AGGTGGCCCCGGTGACGGGGTGG - Intergenic
1175336055 20:58197090-58197112 AGGTGGCCCCGGTGACGGGGTGG - Intergenic
1175336088 20:58197183-58197205 AGGTGGCCCCGGTGACGGGGCGG - Intergenic
1178264746 21:31132581-31132603 CTGTGGTCCCAGTGGCATGGTGG - Intronic
1182302102 22:29342752-29342774 AAGTGGCGACAGTCCCATGGAGG + Intronic
1184031954 22:41900456-41900478 AGGTGGCCCCACTGACGTTGAGG - Exonic
1184035718 22:41917195-41917217 AAGAGGCCCCAGTTCCAAGGGGG - Intergenic
1184737684 22:46408980-46409002 ACGGGGCCCCAGTCACCTGGAGG + Exonic
1185195116 22:49464527-49464549 GAGTGGCCCCTGTGACACTGTGG - Intronic
949529325 3:4938731-4938753 AAGAAGCCCAAGTCACATGGAGG - Intergenic
950288622 3:11765203-11765225 AAGTGGACCCAGGGACTTGCTGG + Intergenic
950410624 3:12834082-12834104 CAGGGCCCCCAGTGAGATGGTGG - Exonic
951564833 3:24002917-24002939 AAGTGTCCCAAGGGAGATGGTGG - Intergenic
951819889 3:26796429-26796451 AAGAAGCCCCAAGGACATGGAGG + Intergenic
956617754 3:71189955-71189977 ACGTGGCCCCAGTGAATTGAGGG - Intronic
958985588 3:100776504-100776526 AAGTGGCACATGTCACATGGTGG + Intronic
964514618 3:157494405-157494427 AAGTGGGACCAGTCTCATGGAGG + Intronic
965449693 3:168822443-168822465 AAGTGGCCCCAAAGACATGATGG - Intergenic
967410985 3:189166362-189166384 AAGTGGGGACACTGACATGGAGG + Intronic
969393040 4:6903323-6903345 AAGTGCCCCCAGTACAATGGAGG + Intergenic
970250019 4:14104689-14104711 GTGTGGCCCCTGTGGCATGGTGG - Intergenic
972347561 4:38205545-38205567 CAGGGGCCCCTGTGGCATGGTGG + Intergenic
979562951 4:122120585-122120607 CAGAGGCCTCAGTGACAAGGAGG + Intergenic
982122985 4:152160014-152160036 AAGTGGCCTCTCTGGCATGGGGG + Intergenic
984823208 4:183902573-183902595 AACTGGGCCCAGGGACATAGGGG + Intronic
985422608 4:189799720-189799742 AAGCGGCCCCATTGCCAAGGCGG + Intergenic
988341441 5:29977269-29977291 AAGTTCCCCCAGTGAAATGAAGG - Intergenic
988568610 5:32342043-32342065 AAGTGGCCCTAGTGACCTGCTGG + Intergenic
989097279 5:37793035-37793057 AAGCTGCCCCAGGGACATGAAGG - Intergenic
989151941 5:38308293-38308315 AAGTGGCCCCATTGGCAGGCAGG - Intronic
990251578 5:53920963-53920985 AAGTGGCCCCAAGGACCTAGAGG + Intronic
990285988 5:54301021-54301043 AAGTTGGCCCAGTGACAGGCAGG - Intronic
990333191 5:54747465-54747487 CAGTGGCCTCTGTGCCATGGAGG + Intergenic
992981692 5:82181527-82181549 AGGTGTCCTCAGTGAGATGGAGG + Intronic
993385201 5:87253997-87254019 AAGTGGCTACAGTAACATGAGGG - Intergenic
996241762 5:121212947-121212969 TAGTGGCCCCAGTGACACTGTGG + Intergenic
999401216 5:151265679-151265701 AAGTGGCCCAAATTTCATGGTGG - Intronic
999879977 5:155851607-155851629 GAGTGGCCCCAGTGATACTGTGG + Intergenic
1001023407 5:168203397-168203419 AAATGACCCTGGTGACATGGAGG - Intronic
1001834903 5:174823763-174823785 AAGTGGCACCTGTGACATTCAGG - Intergenic
1004054439 6:12121490-12121512 AGGGGGACACAGTGACATGGTGG - Exonic
1004262341 6:14118724-14118746 AAGTGGACTGAGTGACAAGGAGG + Intronic
1013176620 6:107683295-107683317 AGATGGCCACAGTGACATGTTGG - Intergenic
1019528240 7:1490621-1490643 GCGTGGCCTCACTGACATGGTGG + Intronic
1021312458 7:19111085-19111107 AACTGGGGCCAGCGACATGGGGG - Intronic
1024052720 7:45639050-45639072 AAGTGGCCCCTGTGACGTGCAGG + Intronic
1024755884 7:52530404-52530426 TAGTGGTCCCAGTGACATTTTGG - Intergenic
1026125307 7:67574327-67574349 AATGGGCCCCAGTGAAATAGTGG + Intergenic
1030087552 7:105829995-105830017 GTGTGTCCCCAGTGACAAGGAGG - Intronic
1034688673 7:152996587-152996609 AAGGTGCCCCAGAGACATGTGGG + Intergenic
1036499013 8:9296288-9296310 AAGATGCAACAGTGACATGGAGG - Intergenic
1036967584 8:13317894-13317916 AAGTTGCTTCTGTGACATGGGGG + Intronic
1040345296 8:46486599-46486621 GTGTGGCACCAGGGACATGGTGG + Intergenic
1043587191 8:81783159-81783181 TAGTAGCCCCTGTGACAAGGAGG + Intergenic
1044399374 8:91752790-91752812 ATGTGGCCCCAGGGTCGTGGAGG - Intergenic
1045223570 8:100222261-100222283 AAGAGGGCCCAGTGTTATGGGGG - Intronic
1045705861 8:104921645-104921667 AAGTGGCCCCAGTTCTATGATGG + Intronic
1054792363 9:69268026-69268048 CAGTGGCACAAGTGACAGGGCGG + Intergenic
1056827635 9:89887789-89887811 AGGTGGCCCCAGTTACCTGCAGG + Intergenic
1057312625 9:93951681-93951703 TAGGGGCCCCAGCGACATCGGGG + Exonic
1058260370 9:102821428-102821450 AATTGGCTCCAGTGACCTGGTGG + Intergenic
1058458231 9:105158170-105158192 ATGTGGCCCAAGTGAAGTGGTGG + Intergenic
1058977520 9:110138232-110138254 CAGTGGCCCGATTAACATGGAGG + Exonic
1060382676 9:123191383-123191405 AAGTGGCTGCAGTGAGGTGGGGG + Intronic
1060854517 9:126904446-126904468 AAGTTGCCAGAGTGCCATGGAGG + Intergenic
1061176641 9:129001672-129001694 ATGTGGCCTCAGTGAAATGCAGG - Exonic
1062174757 9:135155113-135155135 TAGAGGCTCCAGTGAGATGGGGG + Intergenic
1062553915 9:137105442-137105464 CAGAGGCCCTGGTGACATGGGGG - Intronic
1187974184 X:24688626-24688648 AAGTCCCCACAGTGAGATGGTGG - Intergenic
1190071791 X:47285672-47285694 AAGGGGCCCCAGTGAAACAGTGG - Intergenic
1190247842 X:48702265-48702287 CAGTGACCCCAGTGACCTGGAGG + Intronic
1191011209 X:55761371-55761393 AAATGGCCCCAGAGAAGTGGAGG - Intergenic
1193433535 X:81442297-81442319 TTGTGGTCCCAGTGACTTGGGGG - Intergenic
1195523264 X:105855057-105855079 GAGTTGCACCAGTGACCTGGAGG + Intronic
1201071157 Y:10148426-10148448 AAGAGGCCTCAGAAACATGGTGG - Intergenic