ID: 1173670993

View in Genome Browser
Species Human (GRCh38)
Location 20:44798815-44798837
Sequence AGGGAGACGCAGCATGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 368}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173670993_1173670997 -7 Left 1173670993 20:44798815-44798837 CCTGCCCCATGCTGCGTCTCCCT 0: 1
1: 0
2: 1
3: 29
4: 368
Right 1173670997 20:44798831-44798853 TCTCCCTCTCCCTCTCTTGCAGG 0: 1
1: 4
2: 16
3: 218
4: 1808

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173670993 Original CRISPR AGGGAGACGCAGCATGGGGC AGG (reversed) Intronic
900845157 1:5092448-5092470 AGATAGCCTCAGCATGGGGCTGG - Intergenic
901028314 1:6291016-6291038 AGACAGAGGCAGCTTGGGGCTGG + Intronic
901303687 1:8217369-8217391 AGGGCGCCGCAGGAAGGGGCCGG + Intergenic
901637793 1:10678399-10678421 AGGGAGAGGCAGCAGGTGGGTGG + Intronic
901680652 1:10910773-10910795 AGGGACACCAAGCAGGGGGCAGG + Intergenic
902229858 1:15021188-15021210 AGGAAGAGGCAGCATGGAGCAGG - Intronic
903253283 1:22072664-22072686 AGGAAGCCTCAGGATGGGGCTGG - Intronic
903664095 1:24996159-24996181 AGGGAGGAGCAGCATGGAGGGGG - Intergenic
904259224 1:29278984-29279006 AGGGAAAGGCAGCAGGGGCCAGG - Intronic
904420855 1:30390281-30390303 AGGGAGAGGGAGCATTGGGGAGG + Intergenic
904622134 1:31782039-31782061 TGTGAGACCCAGCCTGGGGCTGG - Intergenic
905723599 1:40228904-40228926 AGGCAGAGGCAGCGGGGGGCGGG - Intronic
905734634 1:40316860-40316882 CGGGACAGGCAGCGTGGGGCAGG - Intronic
905772899 1:40649803-40649825 AGGGACAGGCAGCTTTGGGCAGG + Intronic
906656558 1:47552474-47552496 AGAGAGAAGCAGTATGGGTCAGG + Intergenic
909676278 1:78242119-78242141 AGGTAGCCTCAGGATGGGGCTGG + Intergenic
910936638 1:92488343-92488365 AGGGACACGCAGAAAGGAGCAGG + Intergenic
912387021 1:109276034-109276056 TGGGAGAGGCTGCACGGGGCAGG + Intergenic
912703404 1:111895048-111895070 AGGGAGAGGAAGCATGAGGGAGG + Intronic
913162342 1:116155622-116155644 TAGGAGAGGCAACATGGGGCAGG + Intergenic
914195504 1:145446207-145446229 GGATAGAAGCAGCATGGGGCTGG - Intergenic
915859972 1:159433660-159433682 TGAGAGAAGCAGGATGGGGCAGG - Intergenic
915953432 1:160205263-160205285 ATGGAGAGGCAGGAGGGGGCGGG - Intergenic
917387267 1:174491044-174491066 AGGGAGATAGAGCATGAGGCAGG - Intronic
920252498 1:204630864-204630886 TGGTAGATGCAGCATGGGACAGG + Intronic
921361474 1:214334251-214334273 AGGGAGACTCTACATGGGCCTGG + Exonic
922233343 1:223704950-223704972 AGGGAGCGGCAGGAGGGGGCTGG - Intronic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
923552972 1:234978914-234978936 AAGCAGAGGCAGCAGGGGGCAGG + Intergenic
1064685300 10:17855273-17855295 ATGAAGACGCTGCATGCGGCCGG + Intronic
1066628584 10:37435714-37435736 TGGGAGAGTCAGCATGGGACAGG + Intergenic
1067556612 10:47277601-47277623 AGGGAGAGGCAGGAGGTGGCAGG - Intergenic
1067696918 10:48542485-48542507 AGGCAGAGGCAGCAGGAGGCAGG - Intronic
1067784394 10:49233229-49233251 TGGGAGACTCAGAATGGGGGAGG + Intergenic
1067912832 10:50364419-50364441 AGTGAAAAGCAGGATGGGGCTGG - Intronic
1068781631 10:60925085-60925107 AGGGAGAGAGAGCATGGGGTAGG - Intronic
1069226046 10:65945648-65945670 AGGGAGATGCAGGATGGAACTGG + Intronic
1070605917 10:77898496-77898518 TGGGAGATGCTGCATGGCGCAGG + Intronic
1070723960 10:78775363-78775385 CAGGTGACGCGGCATGGGGCAGG - Intergenic
1070932448 10:80271009-80271031 AGGAAGACCCAGAATGTGGCGGG - Intergenic
1072634949 10:97171890-97171912 AGTCAGAAGGAGCATGGGGCAGG - Intronic
1072696727 10:97609441-97609463 AGGGTGAGGCAGGATGGGGTAGG - Intronic
1073103765 10:101020725-101020747 AGGGAGAGTGAGAATGGGGCGGG + Intronic
1073152757 10:101323047-101323069 AGGGAGTAGCAGCCGGGGGCAGG + Intergenic
1075483203 10:122799793-122799815 AGGGAGACCCAGCATAGGCTGGG - Intergenic
1075702827 10:124480148-124480170 AGGAAGAGGCAACCTGGGGCTGG + Intronic
1076456774 10:130605337-130605359 AGAGAGAAGCAGCTTGGGGAGGG + Intergenic
1076821039 10:132939729-132939751 AGGGAGACGCAGCAGGCCGCTGG - Intronic
1076877112 10:133221315-133221337 TGGGAGGCGCAGACTGGGGCTGG + Intronic
1077018546 11:407352-407374 GGTGGGACGGAGCATGGGGCGGG + Intronic
1077076282 11:703629-703651 CTGGAGACGCAGGATGGGGTAGG + Intronic
1077182947 11:1224552-1224574 AGGGAGGGGCTGCCTGGGGCTGG + Intronic
1077307749 11:1875602-1875624 AGGGAGACGCCGCAGTGAGCAGG - Intronic
1078277412 11:9863152-9863174 AAGGAAACCCAGCATGGGACAGG + Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG + Intronic
1079112273 11:17611521-17611543 AGGGACCAGGAGCATGGGGCAGG - Intronic
1080044001 11:27789374-27789396 AGGGAGACCCAGCATGAGCTTGG - Intergenic
1081529366 11:43947459-43947481 AAGGAGAGGCAGGCTGGGGCCGG + Intergenic
1081806010 11:45890922-45890944 AGGGAGACTGAGCAGAGGGCAGG + Intronic
1083612994 11:64013278-64013300 GGGGAGTGCCAGCATGGGGCAGG + Intronic
1083961107 11:66015546-66015568 AGGGACTCCCAGCATGGGGCAGG + Intergenic
1085808308 11:79657270-79657292 AGGCAGCTCCAGCATGGGGCTGG - Intergenic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1089177842 11:116561207-116561229 AGGTAGAGGGAGGATGGGGCAGG - Intergenic
1090634507 11:128682344-128682366 AGAGAGAGGCAGCTGGGGGCAGG - Intergenic
1091591408 12:1845070-1845092 AGGGAGAAGCAGGGTGGGGGTGG + Intronic
1092140248 12:6178816-6178838 ATGGAGAAGCGTCATGGGGCAGG + Intergenic
1096548988 12:52359915-52359937 GGGGAAACACTGCATGGGGCTGG + Intergenic
1096694331 12:53339058-53339080 AGGGAGAGGCGCCATGTGGCAGG + Intronic
1096904132 12:54917370-54917392 AGGAAGACGGAGCCAGGGGCAGG + Intergenic
1097057370 12:56258104-56258126 AGGGGAGCGCGGCATGGGGCGGG + Intronic
1097188471 12:57208375-57208397 GGGCAGAGGCAGCATGGGGAGGG - Intronic
1097243304 12:57591143-57591165 AGGGCGAGGCAGGACGGGGCGGG - Intergenic
1100800050 12:98221547-98221569 AGGAACACGCAGCATGAGTCAGG - Intergenic
1101215063 12:102572928-102572950 AGTGTGAGGCAGCATGGGGCAGG + Intergenic
1102502242 12:113360394-113360416 AGCGAGGCCCAGCATGGGGAGGG + Intronic
1104437120 12:128765374-128765396 GGGGACACACAGCAAGGGGCGGG - Intergenic
1106558866 13:30832230-30832252 AGGGAGCCCAAGTATGGGGCTGG + Intergenic
1108152958 13:47555577-47555599 TTGGAGAAGCAGCATGGTGCAGG - Intergenic
1108678700 13:52760962-52760984 TGGGAGGCCCAGCATGGGCCAGG + Intergenic
1108689792 13:52850265-52850287 AGGGAGACCAAGCAGGGAGCTGG + Intergenic
1112295193 13:98180046-98180068 AGGGAAAGGCTGCATGGGGTGGG + Intronic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113664336 13:112131093-112131115 GGGGAAACGCAGCATGGAGGCGG - Intergenic
1114614294 14:24060085-24060107 AGGGTGGCACAGCAAGGGGCAGG + Intronic
1116817881 14:49599844-49599866 GGGGAGTCGCTGCTTGGGGCCGG + Intronic
1117233697 14:53749245-53749267 AGGAAAACTTAGCATGGGGCAGG + Intergenic
1117287025 14:54295816-54295838 AGGGAAAGGGAGCATGGTGCAGG - Intergenic
1117488877 14:56226259-56226281 ATGGAGAAGCAGCCTGGGCCTGG - Intronic
1118608246 14:67518875-67518897 AGGGAGACGGAGCATGGAAATGG + Intronic
1118882998 14:69844321-69844343 AGGGACACGCAGCCTGGCCCAGG - Intergenic
1119030248 14:71186771-71186793 AGAGAGATGCAGCATGGGGAAGG + Intergenic
1119162225 14:72462210-72462232 TGGGAGAGGCAGCATGATGCAGG + Intronic
1120998544 14:90435106-90435128 AGGGAGACACAGCAAGAGTCTGG - Intergenic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1122268618 14:100558329-100558351 AGGGAGAGGCAGCATGTGCCTGG - Intronic
1122370747 14:101227714-101227736 AGGGAGAAGCAGGTCGGGGCAGG + Intergenic
1122381856 14:101313555-101313577 AGGGAGAAGCAGGTCGGGGCAGG - Intergenic
1122951372 14:105047024-105047046 AGGGAGAGGCCGCATAGGCCAGG - Intergenic
1125503820 15:40255386-40255408 AGACAGATGCAGCATGGGCCAGG - Intronic
1125874807 15:43134197-43134219 AGGAAGAGGCAGCATGGGGAGGG - Intronic
1127642969 15:60932740-60932762 AGGGAGTCTTGGCATGGGGCTGG - Intronic
1127757339 15:62105346-62105368 AGGGAGAAGGAGCAGGTGGCAGG + Intergenic
1128734705 15:70046684-70046706 GGGGAGACGCAGCAGGAGGAAGG + Intergenic
1128756979 15:70189852-70189874 ATGGAGATGCAGCATGGTACAGG - Intergenic
1129265176 15:74389486-74389508 AGGGAGACGAAGCTGGAGGCAGG + Intergenic
1130136392 15:81185065-81185087 AGGGAGGCTCTGCATAGGGCTGG + Intronic
1131542795 15:93288894-93288916 AGTGAATGGCAGCATGGGGCAGG - Intergenic
1131553102 15:93374750-93374772 AGGCAGAGGCAGGATGGGGTTGG + Intergenic
1132640572 16:976463-976485 AGGGAGGCCCAGCCTGGGGGCGG - Intronic
1132643079 16:986837-986859 AGGGAGACGCTGCATGAAACGGG - Exonic
1132831886 16:1932468-1932490 AGGGAGAAGCAGAAAGGGACAGG + Intergenic
1132863439 16:2082584-2082606 AGGCAGACGGACCATGGGGGTGG - Intronic
1133014720 16:2934042-2934064 GGGGAGCCGCAGCATGGAGAGGG - Intronic
1133315002 16:4877410-4877432 GGAGAGGCGCTGCATGGGGCGGG - Exonic
1133848940 16:9483656-9483678 GGGGAGAAGCAGCATGGGAAGGG + Intergenic
1134001641 16:10787474-10787496 AGGGGCAGGCAACATGGGGCAGG + Intronic
1136247927 16:28985825-28985847 AAGGAGACACAGCTTGGGGATGG - Intronic
1136540758 16:30926567-30926589 AGGGGGACGCAGGATGCAGCTGG - Intronic
1136593104 16:31229554-31229576 AGGGAGACCCTGCCTGGGTCAGG - Intergenic
1137775670 16:51052481-51052503 AGGAAGAAACAGAATGGGGCAGG - Intergenic
1138103649 16:54274834-54274856 TGGGAAATGCAGAATGGGGCTGG - Intergenic
1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG + Intergenic
1139306834 16:65993759-65993781 AGGGAGAGGCAGCATGAGCCTGG - Intergenic
1139510761 16:67427251-67427273 AGGGAGACAGGGCTTGGGGCAGG + Intergenic
1139958213 16:70703385-70703407 CTGGAGACCCACCATGGGGCTGG + Intronic
1139973528 16:70791150-70791172 TGGGAGGTGCAGCATGGGCCAGG - Intronic
1140970096 16:80004427-80004449 GGGGAGATGCATCATGGGACAGG + Intergenic
1141021061 16:80496968-80496990 AGGAGGATGAAGCATGGGGCTGG - Intergenic
1141072765 16:80973187-80973209 AGGGAGCCAGAGAATGGGGCCGG + Exonic
1141558893 16:84853839-84853861 AGGGAGACCGAGGCTGGGGCTGG + Intronic
1142940739 17:3378295-3378317 GGGCAGAGGCAGCAGGGGGCTGG + Intergenic
1142968089 17:3593443-3593465 AGGGAGGGGAAGCATGGGGATGG - Intronic
1143103078 17:4514682-4514704 AGGGAGACCCAGGAAGGGGTAGG - Intronic
1143118983 17:4595724-4595746 TGGGAGCCCCAGCATGGGGTTGG + Intronic
1143597276 17:7922873-7922895 AGAAAGACGCAGCAGGGGGCGGG + Exonic
1145244291 17:21258158-21258180 TGGGAGATTCAGCAGGGGGCAGG + Intergenic
1145276823 17:21436642-21436664 AGGGACATGCTGCATGGGGCAGG + Intergenic
1145314656 17:21722535-21722557 AGAGACATGCTGCATGGGGCAGG + Intergenic
1145713108 17:26994472-26994494 AGGGACATGCTGCATGGGGCAGG + Intergenic
1146322679 17:31859049-31859071 AGCCAGCCGCAGCCTGGGGCGGG - Intronic
1146373739 17:32280985-32281007 AGGGAGAGGCAGCAATGGGCCGG - Intronic
1146631645 17:34474286-34474308 AGTGAGGCGGGGCATGGGGCTGG + Intergenic
1147135991 17:38434467-38434489 GAGGAGAGACAGCATGGGGCGGG + Intronic
1147164391 17:38585776-38585798 AGGGAGACTCAACAGGGCGCTGG - Intronic
1147253472 17:39167192-39167214 AGGGAGAAGCCCCATGTGGCTGG - Intronic
1148128261 17:45247831-45247853 AGGGACACGCAGTGAGGGGCGGG - Intergenic
1149564460 17:57631159-57631181 AGGGGGACTCAGAAAGGGGCTGG - Intronic
1149999686 17:61425953-61425975 AGGGAGAGGAAGGATGGGACAGG + Intergenic
1150221984 17:63500943-63500965 AGGGAGAGGCAACATGGGGAGGG - Intronic
1151223989 17:72635024-72635046 ATGGACAAGCAGCATGGCGCTGG - Intergenic
1151243433 17:72776004-72776026 AGGGAGAGGGAACATGTGGCAGG - Intronic
1151395374 17:73819579-73819601 GGGCTGACGCAGCAGGGGGCTGG + Intergenic
1151674164 17:75589308-75589330 TGGGAGAGGAAGCAAGGGGCGGG + Intergenic
1151680419 17:75620060-75620082 AGGGAGATGCAGCATCGGTGAGG - Intergenic
1151975349 17:77481084-77481106 AGGGGTACCCAGGATGGGGCTGG - Intronic
1152474771 17:80510791-80510813 AGTGAGGAGCAGCATGGGGTTGG + Intergenic
1152484906 17:80584068-80584090 AGGGGGACCCAGCAGGGAGCTGG + Intronic
1152728251 17:81958140-81958162 AGGCAGTGGGAGCATGGGGCAGG + Intronic
1156160292 18:34350938-34350960 GGGCAGAGGCAGCAGGGGGCTGG - Intergenic
1157584642 18:48793247-48793269 AGGGAGAAGCAGGGAGGGGCAGG + Intronic
1157637163 18:49169935-49169957 AGGCAGAGACAGCATGGAGCGGG + Intronic
1157876093 18:51275039-51275061 AGGTAGCCTCAGGATGGGGCTGG + Intergenic
1159038744 18:63302798-63302820 AGGGAGTTTCAGCATGGGCCAGG - Intronic
1159916993 18:74196954-74196976 AGGGACAGGCAGCATGGGTAAGG + Intergenic
1160194313 18:76739734-76739756 AGGGAGACACAGCATCGCGAGGG + Intergenic
1160429898 18:78804109-78804131 AGGGGGACGCAGCTTGTGGGTGG + Intergenic
1160508719 18:79441516-79441538 AGGGAGACACATCAAGGAGCTGG - Intronic
1161031781 19:2061103-2061125 AGGGAGATGCGGCTGGGGGCGGG + Intergenic
1161303015 19:3552027-3552049 AGGTAGAGGCAGCAGGGGCCAGG - Intronic
1162029127 19:7909842-7909864 CGGGAGCCCCAGCATGTGGCGGG - Exonic
1162363591 19:10234164-10234186 AGGGAGAGGAACCAGGGGGCAGG + Intergenic
1162831392 19:13286726-13286748 AGGGATGGCCAGCATGGGGCCGG + Exonic
1163551264 19:17967398-17967420 AGGGGGACGCGGTTTGGGGCAGG + Intronic
1164305927 19:24003856-24003878 AGGGAGGAGCAGCATTTGGCCGG + Intergenic
1165013899 19:32867019-32867041 AGGGAAAGGGAGCTTGGGGCTGG - Intronic
1165363936 19:35352465-35352487 CGGGGGAAGGAGCATGGGGCAGG + Exonic
1165387953 19:35522712-35522734 AGTGAGACACGGGATGGGGCTGG - Intergenic
1166050593 19:40256672-40256694 AAGGAGGCGATGCATGGGGCTGG + Intronic
1166229149 19:41415472-41415494 ATGCAGAGGCAGCATGGTGCAGG + Intronic
1167163353 19:47781434-47781456 AAGGAGTCAGAGCATGGGGCAGG - Intronic
1167253907 19:48415835-48415857 AGGGGGACGAAGAGTGGGGCAGG - Intronic
1167455074 19:49593551-49593573 GAGGAGACACAGCAAGGGGCGGG - Intronic
1167763090 19:51461728-51461750 AGGGAGAGGAACCATGGGGCTGG - Intergenic
924982297 2:235328-235350 AATGAGAGGCAGCATGGGTCAGG + Intronic
924987837 2:287939-287961 AGGGGGACGGAGCGCGGGGCGGG + Intronic
925515242 2:4674518-4674540 TGGAAGGGGCAGCATGGGGCTGG - Intergenic
925704826 2:6674381-6674403 AGGGAGATGCAGCATTGGGAGGG + Intergenic
928823592 2:35392018-35392040 AGGCCGAGGCAGCAGGGGGCTGG + Intergenic
929714222 2:44294101-44294123 AGGGAGACAAACCAAGGGGCAGG + Intronic
929756946 2:44774924-44774946 AGGGAAAATCAGCAAGGGGCGGG - Intergenic
929966870 2:46542900-46542922 GGGGAGCCGCTGCATGGGGCCGG + Exonic
930741254 2:54835035-54835057 AGGGAGAAGCAGCGAGGGGAAGG - Intronic
931300417 2:60973520-60973542 GGGCTGAGGCAGCATGGGGCTGG - Intronic
931517585 2:63059066-63059088 AGGGAGACCCTGCGTGGCGCGGG - Intergenic
934475400 2:94590051-94590073 AGAGAGAAGCAGCCTGGGACTGG - Intronic
934517781 2:94999514-94999536 AGGCAGGCGCAGAATGAGGCAGG + Intergenic
936029409 2:109059277-109059299 AAGGTCACACAGCATGGGGCTGG + Intergenic
936152999 2:110031880-110031902 AGGGAGAGGGAGGGTGGGGCTGG + Intergenic
936191681 2:110339532-110339554 AGGGAGAGGGAGGGTGGGGCTGG - Intergenic
937227428 2:120377797-120377819 AGGAGAGCGCAGCATGGGGCCGG - Intergenic
937250876 2:120522914-120522936 AAGAACAAGCAGCATGGGGCTGG + Intergenic
937423916 2:121781644-121781666 AGGGAGACCCAACATGGCGCAGG - Intergenic
937839660 2:126512592-126512614 ATGGAAACGCAGCACGAGGCAGG - Intergenic
938301089 2:130213618-130213640 GGGGAGCCGCTGGATGGGGCCGG - Intergenic
938455627 2:131460849-131460871 GGGGAGCCGCTGGATGGGGCCGG + Intergenic
942084106 2:172428138-172428160 AGGGAGGCGCCGCGCGGGGCGGG - Intronic
942276274 2:174326303-174326325 AGGGATTCGCAGCAGGGGGTGGG - Intergenic
944397904 2:199290128-199290150 AGGGTGACACAGCATGAGTCTGG - Intronic
944812473 2:203341155-203341177 AGGGAGAGTGAGCAAGGGGCAGG - Intronic
945851258 2:215010452-215010474 AGGGAGAAGCAAAATGGTGCTGG + Exonic
946172991 2:217906300-217906322 GGGGAGAAGAAGGATGGGGCTGG - Intronic
946212972 2:218162340-218162362 AGGGAGATTCAACATGGAGCTGG - Intergenic
946252306 2:218421178-218421200 GGTGAGAGGCAGCATGGGGGTGG + Intronic
947463834 2:230324491-230324513 AGGGACACCCAGCAAGGAGCAGG + Intergenic
948615305 2:239194753-239194775 AGGGTGACCCAGCAGGGGCCTGG - Intronic
948787045 2:240358242-240358264 ATGGGGAACCAGCATGGGGCTGG + Intergenic
948855674 2:240729475-240729497 AAGGAGCCCCAGGATGGGGCAGG - Intronic
948925356 2:241092921-241092943 AGGGTGACGCGGCAGGGCGCTGG - Exonic
1169677669 20:8172831-8172853 CCAGAGAAGCAGCATGGGGCAGG + Intronic
1169945010 20:10978959-10978981 AGGGAGACGGGGCAGGGGGAGGG - Intergenic
1170007761 20:11687229-11687251 AGGGGAAAGCAGCATGGGGTGGG - Intergenic
1170900576 20:20458631-20458653 AAGGAGAGGGAGCAAGGGGCTGG + Intronic
1171168549 20:22994746-22994768 TGGGAGAGGCAGGATGGGGTGGG - Intergenic
1171959787 20:31485483-31485505 AGGGAGACCCAGGAGGAGGCTGG - Intergenic
1172008284 20:31831978-31832000 GGGGAGAGGCAGCATGGTGACGG - Intronic
1172624676 20:36340358-36340380 GGGGAACCACAGCATGGGGCCGG - Intronic
1173120733 20:40286959-40286981 AGGGAGCCCCAGCCTCGGGCAGG + Intergenic
1173670993 20:44798815-44798837 AGGGAGACGCAGCATGGGGCAGG - Intronic
1173821227 20:46021885-46021907 AGGTAGAGGCCGCAGGGGGCGGG + Exonic
1173896471 20:46554868-46554890 AGGGAGGAGGAGCATGGGGAGGG - Intergenic
1174515338 20:51087804-51087826 AGGGACCAGCAGCATGGGGATGG - Intergenic
1175739925 20:61413200-61413222 AGGGAAAGGGAGCATGGGCCAGG - Intronic
1175929119 20:62485284-62485306 AGGCAGGCGCAGCCTGGGACGGG - Intergenic
1176148997 20:63579375-63579397 AGGCAGCCTCAGGATGGGGCTGG + Intergenic
1176201038 20:63860682-63860704 AGGGAGGCGCAGCCTGGGAGTGG + Intergenic
1178467143 21:32858944-32858966 AGGCTGAGGCAGCAGGGGGCTGG + Intergenic
1178600686 21:33991987-33992009 AGGGAGAAGCAGAAAGGTGCAGG + Intergenic
1179208904 21:39309442-39309464 AGTGAGACCCAGGGTGGGGCGGG + Intronic
1179290570 21:40014534-40014556 AGGGAGATCCTGCATCGGGCGGG - Intronic
1179539011 21:42072097-42072119 AGGGAGACCCAGAATGGATCAGG + Intronic
1181052733 22:20245475-20245497 AGGGAGACGCAGCCAGGTGGGGG + Intronic
1182490393 22:30667905-30667927 TGGGAGACGCATAAGGGGGCGGG - Intronic
1182722160 22:32411941-32411963 AGGGAAACTCTGCAAGGGGCCGG + Intronic
1183371700 22:37436172-37436194 AGGGTGACCCAGCCTGGGTCAGG + Intergenic
1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG + Intergenic
1183672675 22:39282465-39282487 AGGGACACGCAAGAGGGGGCTGG - Intergenic
1183675476 22:39296901-39296923 AGGGAGCCCCGGCCTGGGGCTGG - Intergenic
1184190154 22:42889138-42889160 ACTGAGACGGAGCATGGGGTGGG + Intronic
1184767436 22:46578915-46578937 AGGGAGATGCAGCTTGGTCCTGG + Intronic
1185009433 22:48304996-48305018 ACGGAGATGCAGCAGGGGGTGGG + Intergenic
950542699 3:13621674-13621696 AATGAGACCCAGCAAGGGGCAGG - Intronic
950631799 3:14286909-14286931 AGGGGAACGTAACATGGGGCTGG - Intergenic
953627686 3:44584657-44584679 AGGGAGTCTCAGCCTGAGGCTGG + Intronic
953996375 3:47523058-47523080 AGGCGGAAGCAGGATGGGGCAGG - Intergenic
954413693 3:50382498-50382520 AGGGAGTGGGAGCAGGGGGCAGG - Intronic
955414746 3:58681482-58681504 AAGGAGGCCCAGCGTGGGGCTGG + Intergenic
955672454 3:61416093-61416115 AGGTAGATGCATCATGGGGGTGG - Intergenic
955768361 3:62367936-62367958 AGGAAGACGCAGCCAGGGGAGGG - Intergenic
956724939 3:72149114-72149136 AGTAATAGGCAGCATGGGGCTGG - Intergenic
957977178 3:87461235-87461257 GGTGAGACGCAGTATGGTGCTGG + Intergenic
957982708 3:87531080-87531102 AGTGAGAGGCTGAATGGGGCTGG + Intergenic
958097304 3:88963247-88963269 AGGCAAGCCCAGCATGGGGCTGG + Intergenic
961523743 3:127483613-127483635 AGGGACAGGCACCATGGGGTGGG - Intergenic
961555923 3:127696708-127696730 ATGAAGAAGCATCATGGGGCCGG - Intronic
961557843 3:127708796-127708818 AGGGAAACTCAGTGTGGGGCAGG - Intronic
961584416 3:127910346-127910368 GGGGCGGAGCAGCATGGGGCAGG + Intergenic
962285724 3:134084358-134084380 AGGGAGAGGCAGCCTGGGAAGGG + Intronic
962845967 3:139274164-139274186 AGGGAGGAGCTGCATGGGGCTGG - Intronic
964470106 3:157043528-157043550 AGGCATAGGCAGCATGGAGCAGG + Intronic
965709776 3:171545602-171545624 AAAGAGACAGAGCATGGGGCAGG - Intergenic
966648032 3:182268711-182268733 AAGGAGAGGCAGCACTGGGCAGG - Intergenic
967323475 3:188216610-188216632 AGTGAGACTCAGAAAGGGGCAGG - Intronic
967732398 3:192918088-192918110 AGGGACGCGCAGCATCGGGGCGG - Exonic
968815125 4:2818109-2818131 ACGGTGACGCGGCAGGGGGCGGG + Intronic
969455481 4:7297523-7297545 AGGGAGACTCAGCAGGGGGCAGG - Intronic
969484468 4:7464421-7464443 AGGGAGCCGCAGCCTGTGGAGGG + Intronic
969488932 4:7487730-7487752 ATGGCCAGGCAGCATGGGGCTGG - Intronic
971483327 4:27133892-27133914 AGGGAGAGGGAACATGGGGGTGG + Intergenic
972408675 4:38769966-38769988 ATGGAGACAAAGCATGGGGAAGG - Intergenic
980982349 4:139665456-139665478 AGTGAGAGGCAGCCTGGTGCAGG + Intergenic
985671020 5:1206728-1206750 AGGGACACGCAGCGTGAGGAGGG + Intronic
986462312 5:7984181-7984203 AGCAAGAGACAGCATGGGGCTGG - Intergenic
988158055 5:27480034-27480056 ACAGAGGCCCAGCATGGGGCGGG + Intergenic
990654230 5:57936559-57936581 ACGGAGATGAAGCTTGGGGCTGG - Intergenic
992394227 5:76357005-76357027 AGGTAGCCTCAGGATGGGGCTGG + Intergenic
992615537 5:78543058-78543080 AGGAATAGGCAGCATGGTGCAGG + Intronic
994822730 5:104675141-104675163 GGGCATAGGCAGCATGGGGCTGG + Intergenic
997702089 5:135909650-135909672 AGGGAGAGGCAGCAGGGTGCAGG + Intergenic
998698482 5:144668702-144668724 GGGGTGAAGAAGCATGGGGCTGG + Intergenic
999088404 5:148913315-148913337 AGGATGAAGCAGCATGAGGCAGG - Intergenic
999639792 5:153661048-153661070 GAGGAGCAGCAGCATGGGGCTGG - Intronic
1000330188 5:160199674-160199696 ATGGAGACGAAGGAGGGGGCAGG - Intronic
1001240734 5:170067907-170067929 AGGGAGGGGCAGGAAGGGGCAGG + Intronic
1001603611 5:172944841-172944863 GGGGAGACCCTGGATGGGGCAGG - Intronic
1001703571 5:173724755-173724777 AAGGAGCCTCAGGATGGGGCTGG - Intergenic
1002568683 5:180128216-180128238 AGGGAGAGGGAGGCTGGGGCGGG - Intronic
1002666881 5:180831593-180831615 AGAGAGGCCCAGCAGGGGGCGGG + Intergenic
1003064598 6:2893006-2893028 AGTGAGAGGCAGTATAGGGCAGG - Intronic
1003271454 6:4611366-4611388 AGGGATACTCACTATGGGGCAGG - Intergenic
1003287464 6:4746910-4746932 GGGGTAACGCAGCATGGAGCAGG - Intronic
1004825007 6:19410147-19410169 TGGGAAAGGCAGCATGGGGCTGG + Intergenic
1005046771 6:21650684-21650706 ATGGAGACACAGCAGGGGGTGGG + Intergenic
1006794373 6:36722376-36722398 AGGGGGGCTCAGCCTGGGGCTGG + Exonic
1007226780 6:40320798-40320820 AGGAAGAAGCAGCATGAGTCTGG + Intergenic
1007234416 6:40379977-40379999 AGGGAGATGGACCATGGGGAGGG + Intergenic
1007351573 6:41277378-41277400 AGAGACAGGCAGCAAGGGGCAGG + Intronic
1007398267 6:41589555-41589577 AGGGAGAGGCTTCATGGAGCTGG + Intronic
1007691276 6:43703052-43703074 AGGGAGACTCAGGATGGGTGGGG - Intergenic
1009588322 6:65635393-65635415 AGGGAAAGGCAAGATGGGGCGGG - Intronic
1010032828 6:71288613-71288635 AGGGAGGCGCGGCCTGGGGCCGG + Intergenic
1011128240 6:84029570-84029592 ATGAAGAGGCAGCATGGGGGTGG - Intergenic
1011472729 6:87723953-87723975 AAAGAGACCCAGAATGGGGCTGG - Intergenic
1013224084 6:108107222-108107244 AGGGAATCGCAGCTGGGGGCTGG - Intronic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1014773398 6:125482214-125482236 TGGGAGAGGCAGCATGTAGCAGG + Intergenic
1017125990 6:151065316-151065338 AGTGAGAGGGAGCCTGGGGCAGG - Intronic
1018565383 6:165146146-165146168 AGGGAGAGGCAGCAAAGGTCAGG - Intergenic
1018618554 6:165709513-165709535 AGAGCGAAGCAGCATGGGGGTGG - Intronic
1018910861 6:168100352-168100374 GGGGAGAGGCGGCATGGGTCGGG + Intergenic
1018919504 6:168161515-168161537 GGGGAGGAGCAGCATGGGGAGGG - Intergenic
1018986382 6:168640346-168640368 ATGGAGAGGAAGCATGGGGCAGG + Intronic
1019073567 6:169369159-169369181 AGGGAGACGCAGCATTTGAGTGG + Intergenic
1019442146 7:1052804-1052826 AGGGACCTGCAGCATGGGGTTGG + Intronic
1019628362 7:2032904-2032926 AGGGAGAGTGTGCATGGGGCAGG + Intronic
1019638301 7:2088626-2088648 AGCGAGAGGCAGCAAGGGGACGG + Intronic
1019883054 7:3880388-3880410 AGCGAGAACCAGCACGGGGCGGG + Intronic
1022588008 7:31634190-31634212 AGGGGGACCCTGCTTGGGGCAGG - Intronic
1022703009 7:32778868-32778890 AATGAGAGGCAGCAAGGGGCAGG - Intergenic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023021662 7:36016952-36016974 AGAGAGAGGCAGGATGGGGCTGG - Intergenic
1023221218 7:37921299-37921321 AGGGAGGAGCTGCAAGGGGCCGG - Intronic
1025197450 7:56943985-56944007 AGGGACACGCAGCATCAGGGTGG + Intergenic
1025674497 7:63632954-63632976 AGGGACACGCAGCATCAGGGTGG - Intergenic
1027501521 7:78957847-78957869 AGGGAGCAGCAGCATCAGGCTGG - Intronic
1028527471 7:91801577-91801599 GGGGTGAAGCAGCAGGGGGCTGG + Intronic
1029422756 7:100479467-100479489 AGGGAGGGGCTGCAGGGGGCGGG + Intergenic
1034099055 7:148436105-148436127 AGGAAGAGCCAGCATGGGGAGGG + Intergenic
1034983741 7:155494831-155494853 AGGGAGACCTGGCATCGGGCAGG - Intronic
1036163135 8:6407037-6407059 GGGGACAGGCAGCATGGGGGAGG - Intronic
1038079655 8:24119542-24119564 AGGGATACTCAACATGTGGCTGG + Intergenic
1038427257 8:27471862-27471884 AGGCAGCTGCAGGATGGGGCTGG + Intronic
1039048499 8:33472269-33472291 AGGGAGCTGCAGCAGGGAGCAGG + Intronic
1040531088 8:48266909-48266931 AGAGGGAGGCAGCCTGGGGCTGG + Intergenic
1042317803 8:67442989-67443011 AGGGAAAAGAAGGATGGGGCTGG - Intronic
1043735073 8:83731156-83731178 GGGGCGAGGCAGCAGGGGGCTGG + Intergenic
1045554935 8:103206780-103206802 GGAGAGAAGCAGGATGGGGCAGG + Intronic
1046035089 8:108831312-108831334 AAGGAGAGGTTGCATGGGGCCGG - Intergenic
1046195660 8:110860287-110860309 GGGCAGACACAGCAGGGGGCTGG - Intergenic
1046752592 8:117941048-117941070 TGTGAGAAGCAGGATGGGGCAGG - Intronic
1047324624 8:123824598-123824620 AGGAAGAGGCAGGATGGGGGTGG - Intergenic
1047343137 8:124001979-124002001 TGGGTGACGGAGCATAGGGCAGG + Intronic
1047566243 8:126047107-126047129 AGGGTGATGCAGGGTGGGGCGGG - Intergenic
1048276225 8:133068007-133068029 AGGGAGTAGCTGCCTGGGGCTGG + Intronic
1048680845 8:136839991-136840013 AGGGAGGCAGAGAATGGGGCAGG + Intergenic
1048714330 8:137251155-137251177 AGGGAGACTCAGAAGGGTGCAGG + Intergenic
1049071661 8:140359890-140359912 AGGGAGCCAAGGCATGGGGCAGG + Intronic
1049163407 8:141111920-141111942 GAGGAGCCGCTGCATGGGGCAGG + Intergenic
1049373562 8:142278853-142278875 AGTGAGGCACAGCGTGGGGCGGG + Intronic
1049627552 8:143632572-143632594 ATGGTGACGCAGGGTGGGGCAGG - Intergenic
1049829970 8:144694191-144694213 AGGAATAGGCTGCATGGGGCAGG + Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052854648 9:33399730-33399752 AGAGAGAAGCAGCCTGGGACTGG + Intronic
1053439429 9:38104066-38104088 AGGGAGGCGTAACAGGGGGCTGG - Intergenic
1053682667 9:40496011-40496033 AGAGAGAAGCAGCCTGGGACTGG + Intergenic
1053932649 9:43124352-43124374 AGAGAGAAGCAGCCTGGGACTGG + Intergenic
1054281047 9:63128918-63128940 AGAGAGAAGCAGCCTGGGACTGG - Intergenic
1054295766 9:63331525-63331547 AGAGAGAAGCAGCCTGGGACTGG + Intergenic
1054393785 9:64636020-64636042 AGAGAGAAGCAGCCTGGGACTGG + Intergenic
1054428433 9:65141233-65141255 AGAGAGAAGCAGCCTGGGACTGG + Intergenic
1054452952 9:65413095-65413117 AGGGAGAAGCAGCCTGGGAGGGG - Intergenic
1054501947 9:65880312-65880334 AGAGAGAAGCAGCCTGGGACTGG - Intronic
1055890943 9:81122835-81122857 AGGGTGACTCAGCATGGGCCTGG - Intergenic
1056820220 9:89836185-89836207 AGCGAGACTCAGCATTGAGCTGG - Intergenic
1057302499 9:93894948-93894970 AGGGAGATGCAGGAAGGGGGCGG - Intergenic
1057429324 9:94979864-94979886 AGGGACAGGGACCATGGGGCAGG - Intronic
1057566135 9:96167554-96167576 TGGGAGACCCAGCATTGGGCAGG - Intergenic
1058412325 9:104747675-104747697 TGGCAGACGCAGGCTGGGGCGGG - Exonic
1059383252 9:113945080-113945102 AGGGAGACAGGGGATGGGGCTGG - Intronic
1060222493 9:121772102-121772124 AGGGAGCGGCAGCAGGAGGCTGG + Intronic
1060730385 9:126033439-126033461 GGGGAGATGCAGGAAGGGGCTGG - Intergenic
1061376130 9:130225929-130225951 TGGGAGACCCGGCAGGGGGCTGG - Intronic
1062061956 9:134501724-134501746 AGGGAGACTCAGCAGGGGTGAGG - Intergenic
1062341251 9:136094847-136094869 AGGGAAACCCAGCAGGCGGCGGG + Intronic
1062473031 9:136714524-136714546 AGGGAGGCCCAGCATGGGCGGGG - Intronic
1062564527 9:137158269-137158291 AGGGAGAAGGAGCAGGGGGAAGG + Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1185611239 X:1394798-1394820 AGGGCGGCTCAGCCTGGGGCTGG + Intergenic
1185648532 X:1632083-1632105 ATGGACAAGGAGCATGGGGCTGG + Intronic
1186032184 X:5380313-5380335 AGGGAAAGGCAGGATGGGGGTGG - Intergenic
1186425850 X:9464501-9464523 AGGGAGATTCACCATCGGGCAGG + Intronic
1188495750 X:30781431-30781453 GGGGAGAGGCATCATGGGGAAGG - Intergenic
1190369438 X:49727093-49727115 GGGCAGAGGCAGCAGGGGGCTGG - Intergenic
1192168780 X:68841766-68841788 AGGAAGAGGCTGCCTGGGGCTGG + Exonic
1192212703 X:69137711-69137733 TGGGAGAGGCAGCCTGGGGTGGG - Intergenic
1192370348 X:70507749-70507771 AGTGAGATGCAGCCTGGGCCTGG - Intergenic
1199720612 X:150540625-150540647 AGGGAGACCCAGCATGTTGGGGG - Intergenic
1200577582 Y:4909069-4909091 AGGTAGCCTCAGGATGGGGCAGG + Intergenic