ID: 1173671891

View in Genome Browser
Species Human (GRCh38)
Location 20:44804771-44804793
Sequence CCCACCAAACAGAACTAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173671879_1173671891 23 Left 1173671879 20:44804725-44804747 CCACATCCTGAAAGGGAAACAAG 0: 1
1: 0
2: 2
3: 25
4: 211
Right 1173671891 20:44804771-44804793 CCCACCAAACAGAACTAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 99
1173671881_1173671891 17 Left 1173671881 20:44804731-44804753 CCTGAAAGGGAAACAAGGTAGAT 0: 1
1: 0
2: 1
3: 18
4: 231
Right 1173671891 20:44804771-44804793 CCCACCAAACAGAACTAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 99
1173671883_1173671891 -9 Left 1173671883 20:44804757-44804779 CCTCTCTCCCCCTTCCCACCAAA 0: 1
1: 1
2: 10
3: 111
4: 1193
Right 1173671891 20:44804771-44804793 CCCACCAAACAGAACTAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173671891 Original CRISPR CCCACCAAACAGAACTAGGT GGG Intronic
901692963 1:10985732-10985754 CACACCAAACAGAAGCAGGCAGG + Intergenic
903885384 1:26537972-26537994 CCCACCTTCCAGACCTAGGTTGG + Intronic
904879890 1:33688227-33688249 CCCATCAAACAGGATGAGGTAGG + Intronic
905968904 1:42125251-42125273 CCCAACAGAAAGTACTAGGTTGG + Intergenic
906327064 1:44853312-44853334 CACAACAAGCAGAACTAGGCCGG + Intronic
908851941 1:68385811-68385833 CTGAGCAACCAGAACTAGGTAGG + Intergenic
921076671 1:211705509-211705531 CCCACCAAGCAGAACTGGTGAGG + Intergenic
921968348 1:221117544-221117566 ACCACCAAAGAGAACTAGGCAGG + Intergenic
1065186972 10:23177977-23177999 CCCACCTGACATACCTAGGTTGG - Intergenic
1067088338 10:43254345-43254367 CCCACCACACAGATCTAAGGGGG - Intronic
1068385422 10:56319903-56319925 CCCACCAATCAGAATGAGGATGG - Intergenic
1069888327 10:71637770-71637792 CCCACCAACCAGAACTCCCTGGG + Intronic
1071525267 10:86354678-86354700 TCCACCAAATAGAGCAAGGTAGG + Intronic
1072921789 10:99583020-99583042 CCCACCAAACCCAACTAAGGTGG - Intergenic
1075615650 10:123889443-123889465 CCCACCACATGGAACTAGCTGGG - Intronic
1078240866 11:9529889-9529911 GCTAGCAAACAGAACCAGGTGGG + Intergenic
1078904981 11:15675538-15675560 CCCACCATCCAGATCCAGGTAGG + Intergenic
1080150801 11:29050178-29050200 CCTACCCAACAGAGCAAGGTAGG - Intergenic
1081228593 11:40556307-40556329 CATAACAAACAGAACTTGGTAGG - Intronic
1083814378 11:65124304-65124326 CCCAACAAATAGAGCTAGGGAGG - Intronic
1088320777 11:108552756-108552778 CCAAACAAACAAAACTAGCTGGG + Intronic
1091561019 12:1613531-1613553 CCCATTAAACAGATCTAGGCCGG - Intronic
1095740007 12:45596631-45596653 CCCCACAAGCATAACTAGGTTGG - Intergenic
1097552586 12:61094074-61094096 GCTACCAAACAGAAATATGTAGG - Intergenic
1100083775 12:90882604-90882626 CCCACAAATAAGAAGTAGGTGGG + Intergenic
1102017991 12:109661111-109661133 CCCACCACACAGAGCCAGGATGG + Intergenic
1102196692 12:111030581-111030603 ACCCCCAAACAGAATTAGCTGGG - Intergenic
1102399918 12:112619811-112619833 GCCACTAAAAAGAATTAGGTAGG - Intronic
1103055489 12:117816904-117816926 CCATCCAAACAGCACTGGGTTGG - Intronic
1105867146 13:24471105-24471127 CCCCCCAGTCAGTACTAGGTGGG - Intronic
1107657304 13:42604724-42604746 CCCACCAAACCAGACTAGGCTGG + Intronic
1114543681 14:23482894-23482916 CCCACCAAACAGACCAAGTGGGG - Intronic
1122236275 14:100332322-100332344 CACACAAAACAGCACTGGGTGGG - Intergenic
1126624364 15:50672034-50672056 CCAACCAAACAAAAATAGGTAGG - Intronic
1128446712 15:67768954-67768976 ACCACCAACCAAAACTAGGATGG - Intronic
1130052938 15:80498839-80498861 CCCACCGAACAGAAGCAGATGGG - Intronic
1130467270 15:84198779-84198801 CCCACAACACTGAACTGGGTAGG + Intergenic
1130496992 15:84474757-84474779 CCCACAACACTGAACTGGGTAGG - Intergenic
1132242125 15:100266067-100266089 CCCTCCAAACAGAACTTGCCTGG + Intronic
1134351617 16:13442945-13442967 CACACCAAATAAAAATAGGTTGG + Intergenic
1134643985 16:15851804-15851826 CCCAACCAAGAGAACTTGGTTGG + Intronic
1138115368 16:54356714-54356736 CCCACCAGACCAAACTAGGTTGG - Intergenic
1138410680 16:56837510-56837532 CCCACCAAAGAGAACTTTCTGGG - Intronic
1138413880 16:56860221-56860243 CCCACCCCACAGCACTATGTGGG + Intergenic
1139522743 16:67494116-67494138 CCCACCAGAAAGAATTATGTGGG - Intergenic
1140219203 16:73031678-73031700 CACAGCAAACAGAACGAGCTGGG + Intronic
1149613377 17:57975721-57975743 CATACCAAAGAGAACTAGCTAGG + Intronic
1150661790 17:67087227-67087249 CCCACCAAAAAGAAAAAGGGCGG + Intronic
1150726919 17:67658687-67658709 CCCAGCAAACAAAGCAAGGTGGG - Intronic
1155554343 18:27001641-27001663 CCCAGCAAACAGAATCAGGAGGG - Intronic
1155998253 18:32355799-32355821 CCCACCAAACCGAACTATTTAGG + Intronic
1160271620 18:77391132-77391154 CCCACAAAAAAGAACTAGAAGGG - Intergenic
1162679493 19:12329874-12329896 TCCAGAAAACAGAAGTAGGTAGG + Intronic
1164676475 19:30104836-30104858 CCCACCACACAGAGCTCTGTGGG - Intergenic
925119710 2:1408749-1408771 CTCACCAAATAGAAGTAGGAAGG + Intronic
925665766 2:6253964-6253986 CCCAACAAACAGAAGTAGCCAGG + Intergenic
928651244 2:33405733-33405755 CCCACGTAAGAGAACTGGGTAGG + Intergenic
931839128 2:66130150-66130172 CCCACCAGAGAGAACTTTGTAGG - Intergenic
934706976 2:96488406-96488428 CCAACAAAATAGAACTTGGTTGG - Intergenic
935132538 2:100271334-100271356 CCCACCACAGAGAAATATGTTGG + Intergenic
940010801 2:149052606-149052628 CCCACCAACCACAGCTCGGTGGG + Intronic
942271538 2:174280548-174280570 CCTAACAAACAAAACTAGGCTGG - Intergenic
1168837656 20:888444-888466 CCCAGCAAGCAGAAGCAGGTAGG + Intronic
1171482257 20:25462813-25462835 ACCAAAAAACAAAACTAGGTGGG - Intronic
1172611702 20:36257198-36257220 CCCACTCATCAGAACTAGCTGGG + Intronic
1173210086 20:41025619-41025641 CCCTCCAAAGAAGACTAGGTAGG - Intergenic
1173671891 20:44804771-44804793 CCCACCAAACAGAACTAGGTGGG + Intronic
1178362800 21:31963655-31963677 CCCACCAAAAAAAATTAGCTGGG - Intronic
1178765260 21:35444691-35444713 ACCACCAAAAAGAGCTAGCTAGG + Intronic
951438659 3:22696103-22696125 CCAAGCAAACATTACTAGGTAGG + Intergenic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
955467835 3:59254787-59254809 CCCACCCAACGGAACTTGGAAGG - Intergenic
957167362 3:76692130-76692152 CTCACCAAAAATAACAAGGTTGG + Intronic
963060171 3:141219434-141219456 CCCACCAATCAGAACTGTGAAGG - Intergenic
964775949 3:160277395-160277417 CCCACTAAACAGTAGTATGTGGG + Exonic
964873469 3:161338930-161338952 CCCATCCAAAAGCACTAGGTAGG + Intergenic
978593759 4:110354910-110354932 CCCACCACACAGAAGAATGTAGG - Intergenic
979860334 4:125685645-125685667 TCCACCTACCACAACTAGGTTGG - Intergenic
980515990 4:133861947-133861969 TCCACCAAACATAACTATTTTGG - Intergenic
980585107 4:134802950-134802972 CCCACCTAAAAGAAACAGGTAGG - Intergenic
983358846 4:166702041-166702063 CCCAGCAAAAAGAACAAAGTTGG - Intergenic
993552249 5:89288110-89288132 CCAACCATACAGAACAAGGCTGG - Intergenic
998391000 5:141786987-141787009 CCCACCATCCAGTTCTAGGTGGG + Intergenic
1000754901 5:165146297-165146319 CCAACCAACCAGAATTATGTTGG - Intergenic
1007344382 6:41217118-41217140 CCCAACAAACACAGGTAGGTTGG - Intergenic
1009679696 6:66875601-66875623 CCCACTAAAGAGATCTGGGTTGG + Intergenic
1014787747 6:125637793-125637815 CCTAACAATCAGAAGTAGGTAGG - Intergenic
1018711446 6:166500638-166500660 CCCAGCAAACAGAACGTGGCAGG + Intronic
1019146836 6:169981160-169981182 CCCACCACTCAGAACAAGGCGGG - Intergenic
1021962925 7:25890375-25890397 CCCAGCACCCAGTACTAGGTTGG + Intergenic
1023736629 7:43241328-43241350 CCCACCAAAGAGAACCTGGATGG - Intronic
1026524075 7:71139606-71139628 CCCACCCAACAGAACTCCCTAGG + Intronic
1030484928 7:110153220-110153242 CACACTAAAGAGAACTAAGTTGG - Intergenic
1030719520 7:112853483-112853505 CACACCAAACAAAATTATGTAGG - Intronic
1032926315 7:136609451-136609473 CCCAAAAATCAGAACTAAGTTGG - Intergenic
1037449654 8:19003876-19003898 CCCACTAAAGAGAACTAATTAGG + Intronic
1041995282 8:64048577-64048599 ACCACCAAAAAGAAATTGGTTGG + Intergenic
1045509863 8:102806199-102806221 CCCATCAAAGGGAACTGGGTGGG + Intergenic
1055471645 9:76617747-76617769 CCAACCAAACAGCCCTACGTAGG + Intronic
1059659965 9:116390959-116390981 CCTACCACACAGAAGTATGTTGG - Intronic
1062011277 9:134268186-134268208 CCCACCAAGCAGATCCTGGTGGG + Intergenic
1187190060 X:17025936-17025958 CCCACAAAACAAAACTGGGGGGG - Intronic
1191710751 X:64148153-64148175 CCCAACACACAGCACTAGGCAGG + Intergenic
1196763964 X:119226173-119226195 CCCACCAAGCAGAAATATCTAGG - Intergenic
1196894250 X:120319222-120319244 CCGACCAAACCAAAGTAGGTGGG - Intergenic