ID: 1173672993

View in Genome Browser
Species Human (GRCh38)
Location 20:44810685-44810707
Sequence CCGGGCCCGGCAGGTGCGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173672983_1173672993 13 Left 1173672983 20:44810649-44810671 CCGGAGGGCGCGGGCTGCGGCCT No data
Right 1173672993 20:44810685-44810707 CCGGGCCCGGCAGGTGCGCGCGG No data
1173672986_1173672993 -7 Left 1173672986 20:44810669-44810691 CCTCTTCTAGCAGCCCCCGGGCC No data
Right 1173672993 20:44810685-44810707 CCGGGCCCGGCAGGTGCGCGCGG No data
1173672982_1173672993 14 Left 1173672982 20:44810648-44810670 CCCGGAGGGCGCGGGCTGCGGCC No data
Right 1173672993 20:44810685-44810707 CCGGGCCCGGCAGGTGCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173672993 Original CRISPR CCGGGCCCGGCAGGTGCGCG CGG Intergenic
No off target data available for this crispr