ID: 1173674775

View in Genome Browser
Species Human (GRCh38)
Location 20:44824172-44824194
Sequence GGCAGATGGTCTTAGACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173674775_1173674781 14 Left 1173674775 20:44824172-44824194 CCTGTAGTCTAAGACCATCTGCC No data
Right 1173674781 20:44824209-44824231 CTCTACGTTGCCCTTTGTGGTGG No data
1173674775_1173674784 26 Left 1173674775 20:44824172-44824194 CCTGTAGTCTAAGACCATCTGCC No data
Right 1173674784 20:44824221-44824243 CTTTGTGGTGGCTGACTCTAAGG No data
1173674775_1173674780 11 Left 1173674775 20:44824172-44824194 CCTGTAGTCTAAGACCATCTGCC No data
Right 1173674780 20:44824206-44824228 CTTCTCTACGTTGCCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173674775 Original CRISPR GGCAGATGGTCTTAGACTAC AGG (reversed) Intergenic
No off target data available for this crispr