ID: 1173675381

View in Genome Browser
Species Human (GRCh38)
Location 20:44830323-44830345
Sequence TTACGCAAACAGATGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173675381_1173675384 29 Left 1173675381 20:44830323-44830345 CCATGCACCATCTGTTTGCGTAA No data
Right 1173675384 20:44830375-44830397 GATGTGTGTATATTTTATGGTGG No data
1173675381_1173675383 26 Left 1173675381 20:44830323-44830345 CCATGCACCATCTGTTTGCGTAA No data
Right 1173675383 20:44830372-44830394 ATAGATGTGTGTATATTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173675381 Original CRISPR TTACGCAAACAGATGGTGCA TGG (reversed) Intergenic
No off target data available for this crispr