ID: 1173679081

View in Genome Browser
Species Human (GRCh38)
Location 20:44863619-44863641
Sequence TCCCTGTGTTGAGGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173679081_1173679084 8 Left 1173679081 20:44863619-44863641 CCAGCACTCCCTCAACACAGGGA No data
Right 1173679084 20:44863650-44863672 ACAAATTTTCCTTTGTTTTATGG 0: 26
1: 17
2: 18
3: 83
4: 931

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173679081 Original CRISPR TCCCTGTGTTGAGGGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr