ID: 1173679084

View in Genome Browser
Species Human (GRCh38)
Location 20:44863650-44863672
Sequence ACAAATTTTCCTTTGTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1075
Summary {0: 26, 1: 17, 2: 18, 3: 83, 4: 931}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173679081_1173679084 8 Left 1173679081 20:44863619-44863641 CCAGCACTCCCTCAACACAGGGA No data
Right 1173679084 20:44863650-44863672 ACAAATTTTCCTTTGTTTTATGG 0: 26
1: 17
2: 18
3: 83
4: 931
1173679079_1173679084 9 Left 1173679079 20:44863618-44863640 CCCAGCACTCCCTCAACACAGGG No data
Right 1173679084 20:44863650-44863672 ACAAATTTTCCTTTGTTTTATGG 0: 26
1: 17
2: 18
3: 83
4: 931
1173679083_1173679084 -1 Left 1173679083 20:44863628-44863650 CCTCAACACAGGGAGAAGAAAAA 0: 7
1: 23
2: 38
3: 108
4: 614
Right 1173679084 20:44863650-44863672 ACAAATTTTCCTTTGTTTTATGG 0: 26
1: 17
2: 18
3: 83
4: 931
1173679082_1173679084 0 Left 1173679082 20:44863627-44863649 CCCTCAACACAGGGAGAAGAAAA 0: 8
1: 26
2: 39
3: 68
4: 587
Right 1173679084 20:44863650-44863672 ACAAATTTTCCTTTGTTTTATGG 0: 26
1: 17
2: 18
3: 83
4: 931

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173679084 Original CRISPR ACAAATTTTCCTTTGTTTTA TGG Intergenic
901161752 1:7182815-7182837 ACATCTTTTCGTTTGTTTAAAGG - Intronic
901949823 1:12734730-12734752 ACAACTTTTGCTTTGTTAAATGG - Intergenic
902351058 1:15855101-15855123 ACAAATCTTCCTTAATTCTAAGG - Intronic
902541144 1:17155829-17155851 ACAGATTTTCCTTTATCTTACGG - Intergenic
903903363 1:26665241-26665263 ATAAATTTTCTTTTGTTTCAAGG - Intergenic
904529127 1:31156451-31156473 AAAAATTTTTCTTTTTTCTAAGG + Intergenic
905839775 1:41165207-41165229 ACAGAATTTCCTCTTTTTTAAGG + Intronic
906897004 1:49786068-49786090 AAACATTTCCCTTTGTTTTCTGG - Intronic
907826382 1:58021101-58021123 TCAAATTTTCCTTTTTCCTATGG - Intronic
908420189 1:63951860-63951882 ACCAATTTTCTTTTTTCTTAAGG - Intronic
908611553 1:65866183-65866205 GTAAATTTGCCTTAGTTTTATGG + Intronic
908699600 1:66884154-66884176 ACAGAATTTCCTTCCTTTTAAGG + Intronic
909168961 1:72269417-72269439 ACTGATTTTCATTTCTTTTAAGG + Intronic
909377979 1:74961760-74961782 ACAACTTTTACTTTGTTAGATGG - Intergenic
909893777 1:81039619-81039641 AATTATTTTTCTTTGTTTTACGG - Intergenic
910014055 1:82498925-82498947 ACAAAAATTTTTTTGTTTTAAGG - Intergenic
910074654 1:83263506-83263528 ATAAATTTTCCTTTTCCTTAAGG + Intergenic
910116546 1:83737931-83737953 AAAAATTTTGTTTTGTCTTAAGG - Intergenic
910270038 1:85384716-85384738 AAAAATTTTCATTTGAGTTATGG - Intronic
910306247 1:85767430-85767452 ACCTTTTCTCCTTTGTTTTATGG - Intronic
910364099 1:86445562-86445584 ACAACTATTCATTTTTTTTAAGG + Intronic
910636094 1:89409660-89409682 ATAAATTTTCCTTTGTTTTATGG + Intergenic
910741767 1:90527009-90527031 ACAAATTTTCCTTTGAGTGCTGG - Intergenic
911280049 1:95913469-95913491 ACAAATGTTTCTTTGAATTAAGG + Intergenic
911302064 1:96186515-96186537 AAAAATTTTCCTCTTTTTGATGG + Intergenic
912046958 1:105470851-105470873 ACAAATTTTCCTTTGTTTTACGG - Intergenic
912114218 1:106384319-106384341 CCAAATTTTCCCTTTTTGTAAGG + Intergenic
912161254 1:106987468-106987490 AGGAATTGTCCTTTGTTTTCCGG - Intergenic
912229146 1:107772280-107772302 ACCATTTTTCTTTTGTTTCATGG - Intronic
912472527 1:109915371-109915393 ACAAATGCCCATTTGTTTTAAGG - Intronic
913648234 1:120883029-120883051 AAAAATTTTTATTTATTTTATGG - Intergenic
914078456 1:144380256-144380278 AAAAATTTTTATTTATTTTATGG + Intergenic
914100723 1:144586246-144586268 AAAAATTTTTATTTATTTTATGG - Intergenic
914173366 1:145248801-145248823 AAAAATTTTTATTTATTTTATGG + Intergenic
914298259 1:146351400-146351422 AAAAATTTTTATTTATTTTATGG + Intergenic
914528017 1:148489937-148489959 AAAAATTTTTATTTATTTTATGG + Intergenic
914638370 1:149577129-149577151 AAAAATTTTTATTTATTTTATGG - Intergenic
914965087 1:152249461-152249483 ACTAATGTTCCTTTTTTTTCTGG + Intergenic
915054962 1:153119825-153119847 ACAAATTTTCCTTTCTTTTATGG - Intergenic
915752741 1:158227389-158227411 ACAAATTTTCCTTTGTTTTATGG + Intergenic
915801684 1:158800293-158800315 GCAACTTTTCCTTTGTGGTATGG - Intergenic
915817765 1:158987908-158987930 TCAAATTTTCCCTTTTTATAAGG - Intergenic
916281193 1:163053246-163053268 AAAAATTTTTCTTTGTCTTTGGG + Intergenic
916287967 1:163131928-163131950 TCAAATTTTCCAAAGTTTTATGG - Intronic
916527879 1:165628794-165628816 ACAAATTTTCCTTTGTTTTATGG - Intergenic
916710977 1:167407880-167407902 ACTAATTTTTTTTTCTTTTATGG - Intronic
916715660 1:167444746-167444768 AGAAATTTACATTTGTTGTAGGG - Intronic
917282360 1:173390592-173390614 ACAAATTTGGTTTTGTCTTAGGG - Intergenic
917301982 1:173585529-173585551 ACAAATTTGACTTATTTTTATGG - Intronic
917322970 1:173802918-173802940 AGTAATTTTTCCTTGTTTTATGG - Intronic
917739689 1:177950603-177950625 ATAATTTTTCATTTGTTTTGTGG - Intronic
918156911 1:181856876-181856898 ACAAAGTTTCATTTGTTTACGGG - Intergenic
918218201 1:182412008-182412030 ACATACTTATCTTTGTTTTAGGG - Intergenic
918272639 1:182917709-182917731 TCCAAATTTCCTTTCTTTTAAGG + Intronic
918421453 1:184368067-184368089 CCAAATTTTCCCTTCTTATAAGG - Intergenic
918494578 1:185119823-185119845 CCAAGTTTTTTTTTGTTTTAAGG - Exonic
918525353 1:185458471-185458493 AGAAATTATGCTTTGTGTTAGGG - Intergenic
919263466 1:195230046-195230068 ACAAATTTGAATTTGTTTAAGGG + Intergenic
919606034 1:199685799-199685821 AAAAAGTTTCCATTGTTTTAAGG - Intergenic
919963472 1:202496457-202496479 AAAAATATTTCATTGTTTTAGGG + Intronic
921040451 1:211426189-211426211 ATATGTTTTCTTTTGTTTTAAGG + Intergenic
921493685 1:215810454-215810476 AGAATTTTTCATTAGTTTTAAGG + Intronic
921615160 1:217257999-217258021 ACATTTTTTCCTGTGTTTTTTGG - Intergenic
921646359 1:217623000-217623022 ACAAAATATTCATTGTTTTAAGG - Intronic
921659579 1:217785163-217785185 CCAAATTTTTCTTTGCTATAGGG + Intronic
921775864 1:219098993-219099015 AAATATTTTCCCTTGGTTTATGG - Intergenic
921808580 1:219484789-219484811 ACAAATATACTTTTGTTTTAAGG + Intergenic
922044571 1:221931695-221931717 ATTAATTTTTTTTTGTTTTAAGG - Intergenic
922656293 1:227387132-227387154 ATAAATTTTCATTTCTTTTAGGG - Intergenic
922849923 1:228723688-228723710 AAAAGTTTTCATTTCTTTTACGG - Intergenic
923221493 1:231898557-231898579 CCAAATTATATTTTGTTTTATGG - Intronic
923580810 1:235210423-235210445 ACAATTTTTCTTTTATTTTTAGG - Intronic
924651800 1:245935701-245935723 ACAGAATTTCCTTCTTTTTAAGG - Intronic
1063083687 10:2793195-2793217 ACAAATGTTCATTTGTATGAAGG + Intergenic
1063103201 10:2969128-2969150 TCAAATTTTCCTTTGACTTTAGG - Intergenic
1063109672 10:3024147-3024169 CCAAATTTTCTTCTGTTTCATGG + Intergenic
1063130952 10:3176024-3176046 CCAAATTTTCCCTTTTTATAAGG - Intergenic
1063469601 10:6273726-6273748 CCAAATTTCCCTTTTTTATAAGG - Intergenic
1063478872 10:6353153-6353175 AAAAATATGCCTTTGTTTTATGG + Intergenic
1063941762 10:11136934-11136956 AGAAATTCACCTTTGCTTTATGG - Intronic
1064818214 10:19291780-19291802 ACAAATTTTATTTTTTTTAATGG - Intronic
1064838978 10:19568390-19568412 TCAAAGTTTCTTTTCTTTTAAGG + Intronic
1065074115 10:22059835-22059857 ACAGAATTTCCTTCCTTTTAAGG + Intergenic
1065124071 10:22556029-22556051 TTAAAATTTCCTTTGTTTTTAGG + Intronic
1065799818 10:29341944-29341966 ACAAATTTTTGTTTGATTTGGGG + Intergenic
1066191786 10:33062619-33062641 ACAAGATTTCCTTCCTTTTATGG - Intergenic
1066320954 10:34303470-34303492 AAATATTTTCCTTTTTTTTTTGG - Intronic
1067180554 10:43982722-43982744 AAAAAATATCCTTTTTTTTAAGG - Intergenic
1067308576 10:45091296-45091318 ACAGCTTTTAGTTTGTTTTATGG + Intergenic
1067708857 10:48632831-48632853 ACAGATTTTACCTTGTTGTAAGG + Intronic
1067740612 10:48893229-48893251 CCAAATTTTCCCTTTTTATAAGG + Intronic
1067884818 10:50078460-50078482 AAAAATTTTCTTTTTTTTTTTGG + Intronic
1067920695 10:50453961-50453983 AAAGATTTTGCTTTGTTTTTAGG - Intronic
1068382789 10:56279642-56279664 ACTCATTTTCCTATGTGTTATGG + Intergenic
1068689231 10:59899077-59899099 TCAAATTTTCTTATCTTTTATGG - Intronic
1068721541 10:60251553-60251575 ACAAATTTTCAAATCTTTTAAGG + Intronic
1068999629 10:63248892-63248914 ACAAGTTTTCATTCTTTTTATGG - Intronic
1069166345 10:65165554-65165576 ACAATTTTTCCTTTATATTTAGG - Intergenic
1069388575 10:67908493-67908515 CCAAATTTTCCTATATTTTTTGG - Intronic
1070148034 10:73788888-73788910 ACAATGTCTCCTTTGTTCTATGG - Intronic
1070208276 10:74286849-74286871 ACAAATTTTTTTATTTTTTAAGG + Intronic
1070265131 10:74894740-74894762 ACAAGATTTCCTTCTTTTTAAGG + Intronic
1070682170 10:78456326-78456348 CCAAATTTTCCCTTTTTATAAGG - Intergenic
1071234155 10:83624882-83624904 CCAAATTTTCCTGTGCTATAAGG - Intergenic
1072025720 10:91454275-91454297 TCAAAATTTCAGTTGTTTTATGG - Intronic
1072405085 10:95143860-95143882 TCAAAATTTACTTTCTTTTAAGG + Intergenic
1072511321 10:96129136-96129158 ACATATTTTTCATTGTCTTAGGG - Intergenic
1072874879 10:99161849-99161871 ACAGGATTTCCTTTCTTTTAAGG - Intronic
1073348771 10:102804022-102804044 ACATTTTTTACTTTTTTTTATGG - Intronic
1073739847 10:106393997-106394019 CCAAATTTTCCCTTTTTATAAGG + Intergenic
1074328340 10:112475775-112475797 ACAAATTTGGCTTTGTTAGATGG + Intronic
1074357997 10:112802870-112802892 TCAAAATGTCCCTTGTTTTATGG - Intronic
1074378990 10:112962954-112962976 ACAGATCTTCTGTTGTTTTAGGG + Intronic
1075369316 10:121921490-121921512 ATAAATTTTCCTTTGTTTTACGG + Intronic
1075848380 10:125565826-125565848 AACAGTTTTCTTTTGTTTTAAGG - Intergenic
1076089256 10:127666744-127666766 ACATTTTTTCCTCTGCTTTATGG - Intergenic
1078120596 11:8504795-8504817 ATTTATTTTCCTTTTTTTTAGGG - Intronic
1079221742 11:18568741-18568763 ATGCATTTTACTTTGTTTTATGG - Intronic
1079448091 11:20574560-20574582 TCAAATTTTCCTCTCTTTTTGGG - Intergenic
1080262153 11:30361075-30361097 ACAAATTTCTCTATGTCTTAGGG - Intergenic
1080325882 11:31072569-31072591 CCATATTTTCTTCTGTTTTATGG + Intronic
1080909897 11:36585667-36585689 AGAAACTTTCCTTTCTTTTAAGG + Intronic
1080956463 11:37102149-37102171 AAAAATTTTCCTTTTGTTTTAGG + Intergenic
1080999697 11:37653724-37653746 ACAGAATTTCCTTCTTTTTAAGG - Intergenic
1081037978 11:38174051-38174073 ACAAATTTTCCTTTGTTTTATGG - Intergenic
1081063982 11:38516924-38516946 ACATATTTTGGTTTGTTTGATGG + Intergenic
1081396917 11:42596965-42596987 ACATATGTTCCTTGATTTTATGG - Intergenic
1082130650 11:48485067-48485089 CCAAATTTTCCTATCTATTAAGG - Intergenic
1082695495 11:56358772-56358794 ACTAGTTATCCCTTGTTTTATGG - Intergenic
1082711505 11:56558990-56559012 ACAAAATTTGTGTTGTTTTAAGG - Intergenic
1085148717 11:74229596-74229618 ACAATTTCTCATTTGTTTGAAGG - Intronic
1086213421 11:84348764-84348786 ACAAATTTTCCCTTCTTTTAAGG - Intronic
1086611366 11:88759753-88759775 ATATATATTCCTTTGTTTTGGGG - Intronic
1087032210 11:93716977-93716999 ACAAATTTTCCTTTGTTTTATGG - Intronic
1087102521 11:94379558-94379580 AATAATTTCCCTTTGTTTTAAGG + Exonic
1087233134 11:95688742-95688764 AAAAATTTTCCCTTGATTAAGGG - Intergenic
1087303542 11:96462757-96462779 CCAAATCTTCTTTTCTTTTAAGG + Intronic
1087591510 11:100195032-100195054 ACACATTTTGCTCTGCTTTATGG + Intronic
1087718419 11:101635720-101635742 AATAATTTTCCTTTTTTTTTTGG - Intronic
1087871261 11:103295489-103295511 ACAAATTTTTCTTTCTCTTATGG + Intronic
1088097708 11:106119302-106119324 AGACATTTTCTTTTGATTTATGG + Intergenic
1088103889 11:106184385-106184407 AAAAATTTTCCTTTTTGTTCAGG - Intergenic
1088142959 11:106639901-106639923 ACAAATCTTACTTTTGTTTAAGG + Intergenic
1088250897 11:107859926-107859948 ACACCTTTTCTTTTGTTTTCTGG - Intronic
1088322093 11:108564723-108564745 TCAAATTTTCCCTTGTATGACGG + Intronic
1088346556 11:108833564-108833586 AAAACTTTTTATTTGTTTTAGGG - Intronic
1088906341 11:114158000-114158022 ACACTTTTTCTTCTGTTTTAGGG + Intronic
1089166940 11:116484602-116484624 CCAAATTTTCCCTTTTTGTAAGG - Intergenic
1089575502 11:119439687-119439709 ACAAAGTTTTCTTTGTGATAAGG - Intergenic
1089875966 11:121722626-121722648 ACACATGTTCCTTTGTTTGGCGG - Intergenic
1089994369 11:122891184-122891206 AGAAATTTTCCTTGGTTTTAAGG - Intronic
1090101070 11:123797425-123797447 ACAAATTTTCCTTTCTCTTATGG - Intergenic
1090101793 11:123805408-123805430 TCAAGTTTTCCTTTGTATCAAGG + Exonic
1090280368 11:125451202-125451224 ACTAAGTTTCTTTTTTTTTAAGG - Intronic
1090551271 11:127822474-127822496 ATAAATCTTCTTATGTTTTAGGG + Intergenic
1090565956 11:127992589-127992611 AAAAATTTTCCTTTTTTGCAAGG + Intergenic
1090861627 11:130658581-130658603 ATAAATTGACATTTGTTTTATGG - Intergenic
1091490629 12:929633-929655 ACAGTTTTTCCATTCTTTTAGGG + Intronic
1091910113 12:4223726-4223748 ACGAAATTTGCTTTGTCTTAAGG - Intergenic
1092027551 12:5255467-5255489 GCAAAATTTCCTTTATTTTAAGG + Intergenic
1092443826 12:8534642-8534664 AGAGATTTTCCTTTGTTCAAAGG + Exonic
1092510529 12:9151094-9151116 AAAACATTTTCTTTGTTTTATGG + Intronic
1093685711 12:22051612-22051634 GATAATTTTCCTTTGGTTTAGGG - Intronic
1093788965 12:23224631-23224653 ACAAAATTGCCCTTGTTTGATGG - Intergenic
1095187438 12:39217028-39217050 ATAAATTTTCTTTTCTTTTCTGG - Intergenic
1095453875 12:42361483-42361505 ACAAAATTTTGTCTGTTTTAAGG - Intronic
1096521092 12:52185142-52185164 ACAAGATTGACTTTGTTTTAAGG + Intronic
1097138294 12:56878330-56878352 ACAAATTTTCCTTTCTCTTATGG - Intergenic
1097416417 12:59321720-59321742 ACAATTTTGCCTTTGTTTCATGG + Intergenic
1097750837 12:63350404-63350426 AATATGTTTCCTTTGTTTTAGGG - Intergenic
1097786858 12:63770168-63770190 ACAAATTTTTTTATGTTTTTAGG + Intergenic
1097829269 12:64206706-64206728 ACAAGATTTCCTTCTTTTTAAGG - Intronic
1097838166 12:64294494-64294516 TCACAATTTCCTTTTTTTTAAGG - Intronic
1098070800 12:66672419-66672441 TCAAAGTTTCCTTGGTTTGAAGG + Intronic
1098464684 12:70773133-70773155 CCAAATTTTCCCTTTTTATAAGG + Intronic
1098490347 12:71068624-71068646 ACAAATATCCATGTGTTTTACGG - Intronic
1098506586 12:71258801-71258823 GCAGAATTTCCTTTATTTTAAGG - Intronic
1098591077 12:72213732-72213754 ACAAATTTTGTTTTATGTTATGG - Intronic
1098803210 12:74987628-74987650 AGAAACTTTTCTTTGTTGTATGG - Intergenic
1098915320 12:76251319-76251341 ATAAATTTGGCTTTGTATTAGGG + Intergenic
1099047652 12:77742586-77742608 ATAAATTTTTTTGTGTTTTATGG - Intergenic
1099346152 12:81502308-81502330 ACCAATTTTCCTTTGTTTTAGGG - Intronic
1099502034 12:83425788-83425810 ACATAATATCATTTGTTTTATGG + Intergenic
1099560497 12:84167406-84167428 TCAAATTTCCCTTTATATTATGG - Intergenic
1099738772 12:86602930-86602952 ACACAATTTCCTTCTTTTTAAGG - Intronic
1099804588 12:87501872-87501894 ACAAATCTTTATTTGTTTTCAGG + Intergenic
1099808960 12:87556473-87556495 ACATTATTTCCTTTCTTTTAAGG - Intergenic
1100015515 12:90005959-90005981 CCAAATTTTCTTTTCTTGTAAGG - Intergenic
1100026578 12:90136117-90136139 ACATAATTTCATTTTTTTTATGG + Intergenic
1102360236 12:112280224-112280246 ATACATTTTTCTTTTTTTTAAGG + Intronic
1102671060 12:114619308-114619330 ATAATTTTGCCTTGGTTTTATGG - Intergenic
1102831131 12:116000947-116000969 ACATATTTTACTTTTTTTTTTGG - Intronic
1103380150 12:120487909-120487931 ACAAATTTTCCTTTGTTTTATGG - Intronic
1104128282 12:125868338-125868360 TCAAATATTTCTTTGTTTTCTGG - Intergenic
1106170269 13:27282757-27282779 CCAAATCTTCCTTTTTTATAAGG - Intergenic
1106270923 13:28152592-28152614 ACACATTTTTTTTTGTTTTTTGG - Intronic
1106328197 13:28715087-28715109 AAAAATGTTCCTTTGTCCTAAGG + Intronic
1106636441 13:31533661-31533683 CCAAATTTTCTTTTCTTTTAAGG + Intergenic
1106751279 13:32771123-32771145 ACCTATTTTCCTTTTTTTAAAGG - Intronic
1106945700 13:34825121-34825143 TCATATTTTCCTTCCTTTTAAGG + Intergenic
1107029625 13:35837473-35837495 ACAATTTTGCCTCTGTTTGAAGG + Intronic
1107372116 13:39763864-39763886 TGTAATTTTCCTTTGTTTAAAGG + Intronic
1107443214 13:40446752-40446774 CCAAATTTCCCTTTTTTATAAGG - Intergenic
1107534885 13:41319511-41319533 AAAAATTTTTTTTTGTTTTTTGG + Intronic
1107686863 13:42909596-42909618 ACAAGATTTCCTTCTTTTTATGG - Intronic
1107856839 13:44624526-44624548 AAAAATTTTGCTTAGTTTTCTGG + Intergenic
1107914288 13:45133494-45133516 ACAAATTTTCATTTGTTTTATGG + Intronic
1108337786 13:49463795-49463817 ACAAATTTTCCTTTCTCTTATGG - Intronic
1109043811 13:57379941-57379963 ACAAATTTTTGTAGGTTTTAGGG + Intergenic
1109136259 13:58655197-58655219 ATAAGATTTACTTTGTTTTATGG - Intergenic
1109241472 13:59895049-59895071 ATAAATTTTAATTTGTTTAAGGG - Intronic
1109398197 13:61788930-61788952 ATAAATTTTCATTTGTTTTATGG - Intergenic
1109404142 13:61875564-61875586 ACAAATTTTCCTTTCTCTTATGG - Intergenic
1109434078 13:62275359-62275381 ACAAATTCTTTTTTATTTTAAGG + Intergenic
1109462121 13:62674657-62674679 ACAAATTTTCTTTCTTCTTATGG + Intergenic
1109501216 13:63238067-63238089 TCAAAAGTTTCTTTGTTTTAGGG - Intergenic
1109540389 13:63769750-63769772 GCAAATTTTAATTTGTTTTTAGG - Intergenic
1109576628 13:64267490-64267512 CCAAATTTTCCCTTTTTATAAGG + Intergenic
1109598108 13:64584310-64584332 ACAAATGTTACTTTGGTTTTAGG + Intergenic
1109646661 13:65266815-65266837 ACAAACTTTTGTTTGTTTGATGG + Intergenic
1109830279 13:67777266-67777288 ACAAAATTTCATTCTTTTTATGG - Intergenic
1109916311 13:68989089-68989111 ACAAATGTTCCAATGTTTGAGGG - Intergenic
1110036985 13:70700017-70700039 ATAAATCCTCCATTGTTTTAAGG + Intergenic
1110086218 13:71384006-71384028 ACAGAATTTCCTTTTTTTTAAGG + Intergenic
1110117197 13:71834053-71834075 TCAAATGTTCCTTTGTTTCCAGG + Intronic
1110192166 13:72742831-72742853 ACAAAATTTCCTCTTTTTTAAGG - Intronic
1110696814 13:78500800-78500822 TTAAATTATACTTTGTTTTAGGG + Intergenic
1110734284 13:78917107-78917129 AAATCTTTTTCTTTGTTTTAAGG + Intergenic
1110869400 13:80432675-80432697 GCAAATTTTTCTTTTGTTTAAGG + Intergenic
1110970335 13:81753596-81753618 TGAAATTTTCCGTTTTTTTATGG + Intergenic
1111010493 13:82307258-82307280 ACAGAATTTTCTTTTTTTTACGG + Intergenic
1111023005 13:82479308-82479330 ACAAATATTCTTAGGTTTTATGG - Intergenic
1111047046 13:82828077-82828099 ACATTTTTTCCTTGGTTTTATGG - Intergenic
1111413089 13:87902556-87902578 ACTAATTTTATTTTATTTTATGG + Intergenic
1111422604 13:88034647-88034669 ACAAATTTTCTTGGATTTTAAGG + Intergenic
1111513530 13:89297622-89297644 ACAAATTTTCCCATATTTTCAGG + Intergenic
1111637294 13:90921605-90921627 AGCACTTTTCCTTTCTTTTACGG - Intergenic
1111696624 13:91632523-91632545 TTATATTTTCCTTTGTTTTTTGG - Intronic
1111798164 13:92949888-92949910 TCAAATCTTCCTTTATTTTTAGG + Intergenic
1111924359 13:94446850-94446872 CCAAATTTTCCCTTTTTATAGGG + Intronic
1111942518 13:94625945-94625967 TCACTTTTTCCTTTGTTTCAGGG + Exonic
1112150094 13:96749701-96749723 ACAAATTTTAATTTCTTCTATGG + Intronic
1112473343 13:99709154-99709176 CCAAATTTTCTCTTTTTTTAAGG - Intronic
1112484006 13:99803303-99803325 ACAATGTTGCCTTTGTTCTAGGG - Intronic
1112696256 13:101952298-101952320 AGAAGTTTCCCTTTGTTATACGG + Intronic
1112759959 13:102683938-102683960 ACAACTTTTCTTCTGTTTTGGGG + Intergenic
1112815473 13:103268145-103268167 ACATTTTTTCCATTGTCTTAGGG - Intergenic
1112990709 13:105510340-105510362 GCAAACTTTCCTTTATTTTCAGG + Intergenic
1113260568 13:108557692-108557714 AAAAGTTTTCTTTTCTTTTAAGG - Intergenic
1113539854 13:111097848-111097870 ACAATTGTTCCATTATTTTATGG - Intergenic
1114494694 14:23124610-23124632 ACAAATTTACTTTTCTTGTAAGG - Intergenic
1115198867 14:30832273-30832295 ACATAGTTTCATTTGTTTAAAGG - Intergenic
1115252505 14:31364298-31364320 ACACTTTTTCTTTTATTTTAAGG - Exonic
1115665211 14:35537232-35537254 AAAAATTTTCCTTTGAAGTATGG + Intergenic
1115801314 14:36997040-36997062 ACAAATTGTCCTGTGGTTCAGGG - Intronic
1116053004 14:39827512-39827534 ACAAATTTTCTCTTTTTATAAGG + Intergenic
1116139729 14:40976167-40976189 TAAAATTTTCTTTTGTTTTCAGG - Intergenic
1116197110 14:41742362-41742384 AAAAAATTTCCTTATTTTTATGG - Intronic
1116279314 14:42882326-42882348 ACAACTTTTAATATGTTTTATGG + Intergenic
1116339867 14:43708747-43708769 ATGAATTTTCCTTTGATTTCTGG - Intergenic
1116532437 14:45989255-45989277 TACATTTTTCCTTTGTTTTATGG + Intergenic
1116568509 14:46484278-46484300 ATAATTTTTTCTTTGTTTTGGGG + Intergenic
1116673643 14:47876522-47876544 CCAAATTTTGATTTGTTTTGGGG + Intergenic
1116707951 14:48327409-48327431 ATAGATTTTGATTTGTTTTAGGG - Intergenic
1117059710 14:51949718-51949740 ACAAATCTTACTTTGTGTCAAGG - Intronic
1117514158 14:56483838-56483860 ACAAATCTACCTTTGTTAAAGGG - Intergenic
1117602438 14:57390067-57390089 TCAAATCTTCCTTTCTTTTTCGG + Intergenic
1117612459 14:57498708-57498730 ACAGAATTTCCTGTTTTTTAAGG + Intergenic
1117682529 14:58219531-58219553 AAAAATTTAATTTTGTTTTAGGG - Intronic
1117760518 14:59022453-59022475 ACAAAATCTCATTTGTTTTCTGG - Intergenic
1117762727 14:59048732-59048754 AAAATATTTCCTTTATTTTATGG + Intergenic
1117854869 14:60018491-60018513 ACAAATTTTTCTTTCTTTCAAGG + Intronic
1118079331 14:62340040-62340062 ACACATTTTCATGTGATTTAAGG + Intergenic
1118754528 14:68830066-68830088 ACACATTTTATTTTATTTTAAGG + Intergenic
1118919033 14:70133139-70133161 CCAAACTTTCCTTGGTTTTGTGG - Intronic
1119979843 14:79067678-79067700 TCAAATTTACCTTTCTTATAAGG + Intronic
1120154840 14:81082138-81082160 ACAAATTTTCCTTTGTTTTATGG + Intronic
1120502750 14:85317363-85317385 ACAGATTTTACTTTGTTCCAGGG - Intergenic
1120609369 14:86621663-86621685 ACAAATTTCCCTTATTTATAAGG + Intergenic
1120637630 14:86971509-86971531 TCAAGTTTTCCTTTGTTTTAGGG + Intergenic
1120671350 14:87366000-87366022 GAAAATTTTCCCTTTTTTTAAGG + Intergenic
1120872133 14:89347267-89347289 CCAAATTTTCCCTTCTTGTAAGG - Intronic
1121223875 14:92307100-92307122 AGAAATACTCCTTTGTTTTAGGG + Intergenic
1121343876 14:93120971-93120993 ACATGTTTATCTTTGTTTTAAGG + Intergenic
1122052908 14:99072395-99072417 ACATATTTTTGTTTGTTTTGGGG + Intergenic
1122339564 14:101019441-101019463 GGAATTTTACCTTTGTTTTAAGG + Intergenic
1122524002 14:102367221-102367243 TGATATTTTCCTTTGTTTTTTGG + Intronic
1123706100 15:22952053-22952075 TCAGAATTTCCTTTCTTTTAAGG - Intronic
1123952972 15:25301684-25301706 AAAAATTGTGCTTTGTTTTATGG + Intergenic
1124572534 15:30878165-30878187 CCAAATTTTTCTTTTTTATAAGG - Intergenic
1125009358 15:34853958-34853980 ACAAAATTTCATTTGTTTACAGG + Exonic
1125119432 15:36136386-36136408 CCAAATTTCCCTTTCTTATAAGG + Intergenic
1125213551 15:37242431-37242453 ACATGTTTTCATATGTTTTATGG - Intergenic
1125340696 15:38672597-38672619 ACAATTTTTGGTATGTTTTAGGG + Intergenic
1125846012 15:42854670-42854692 GGAAATTTTCATTTGGTTTAAGG - Intronic
1126353101 15:47765548-47765570 ATAAATTTTCCTGTGTTAGATGG - Intronic
1126437617 15:48651991-48652013 ATAAATAAACCTTTGTTTTAGGG + Intergenic
1127109881 15:55657241-55657263 ACATAGTTTCTATTGTTTTATGG + Intronic
1127156085 15:56126219-56126241 AGGGATTTTCCATTGTTTTATGG - Intronic
1127235253 15:57043074-57043096 AGAATTTTTTCTTTCTTTTAAGG + Intronic
1127592021 15:60434583-60434605 ACAGAATTTCATTTCTTTTATGG - Intronic
1127905534 15:63373356-63373378 ACAAATTTTTTTTTTTTTTTTGG - Intronic
1128117368 15:65118441-65118463 CCAAATTTGCCTCTGTTTTGAGG - Exonic
1128945252 15:71815374-71815396 ACAAATCTTCCTGTGCTATATGG - Intronic
1129078929 15:73022665-73022687 ACACATTTTTCTGTGTTTTCAGG - Intergenic
1129570103 15:76672935-76672957 ATAAATTTTCTTTTTATTTAAGG - Intronic
1130107810 15:80942247-80942269 AGAAATGGTCCTTTGTTTTCTGG - Exonic
1131289742 15:91097019-91097041 ACAAATCTTTCTTTGTCTCAGGG - Intergenic
1131403393 15:92144394-92144416 ACAAATGTTACTCTTTTTTAAGG - Intronic
1131824881 15:96312239-96312261 ACAAGTTTTCCTTTGTTGTAGGG - Intergenic
1131905282 15:97135501-97135523 AAATATTTTCCTTTCTTCTATGG - Intergenic
1132200361 15:99949334-99949356 ACAGAATTTCCTTCTTTTTAAGG + Intergenic
1133569883 16:7030847-7030869 ACATTTTTTCTTTTGTCTTAGGG + Intronic
1133833613 16:9347339-9347361 ATATTTTTTCCTTTGTTTTGTGG + Intergenic
1133850782 16:9501295-9501317 AGAAATATTTCTTTGTTTGAAGG + Intergenic
1134323860 16:13188939-13188961 CCAAATTTCCCTTTGTTATAAGG - Intronic
1134892030 16:17849434-17849456 ACAACATTTCCTTCTTTTTAAGG - Intergenic
1135589410 16:23694570-23694592 ACAAATTATCCCTTCTTTAAGGG + Intronic
1138752449 16:59440167-59440189 CCAAATTTCCCTTTATTATAAGG - Intergenic
1138800638 16:60023756-60023778 ACAAATTTTCCTTTTGATTTTGG + Intergenic
1138841016 16:60506029-60506051 TAAAATTTTTATTTGTTTTAGGG - Intergenic
1139160220 16:64497044-64497066 ACAACTTTTGCTTTATTTCAAGG + Intergenic
1140324324 16:73986984-73987006 ATAATTTTTTCTTTGTTTTAGGG + Intergenic
1140419399 16:74806112-74806134 ACAATATTTCCTTCTTTTTAAGG + Intergenic
1140637044 16:76927088-76927110 CCTAATTTTTCTTTGTTTAATGG + Intergenic
1140993401 16:80235958-80235980 ATAAATTTTGCTTTGATTTTTGG + Intergenic
1141357427 16:83361193-83361215 ACAATTTTTCATATGTTTTTTGG + Intronic
1144219644 17:13088472-13088494 ACAAATTTTTTTTTATTTTTTGG + Intergenic
1145361112 17:22213196-22213218 ACAAATTTTCCTTTGTTTTATGG + Intergenic
1145961704 17:28890196-28890218 ACAAGTTAGCCTTTGTTTTGAGG - Intronic
1146581667 17:34044034-34044056 ACAAATTATCTTTGTTTTTATGG + Intronic
1147071555 17:37962176-37962198 ACAAATTTCCCCTTTTTATAAGG - Intergenic
1147083082 17:38041700-38041722 ACAAATTTCCCCTTTTTATAAGG - Intronic
1147099025 17:38165673-38165695 ACAAATTTCCCCTTTTTATAAGG - Intergenic
1147841115 17:43372150-43372172 ACAAATTTTCCTTTGTTTTATGG + Intergenic
1148377334 17:47160087-47160109 ATAAATTTTCCTTTTCATTAAGG - Intronic
1149067853 17:52501465-52501487 ATATTTTTTCATTTGTTTTAAGG + Intergenic
1149238755 17:54624072-54624094 CCAAATTTTCCCTTCTTATAAGG + Intergenic
1149748736 17:59124898-59124920 ACAGTTTTTCCTTTGTGGTATGG - Intronic
1150080560 17:62234716-62234738 ACAAATTTCCCCTTTTTATAAGG - Intergenic
1150212250 17:63447572-63447594 ACAAATTTTCTGTTGTTGGAGGG - Intergenic
1150582143 17:66483759-66483781 CCAAATTTCCCTTTTTTGTAAGG + Intronic
1150911583 17:69393429-69393451 TCTAATTTTTCTTTGTTTTCTGG + Intergenic
1151178862 17:72311326-72311348 CCAAATTTCCCTTTTTTATAAGG - Intergenic
1152051575 17:77982913-77982935 ACAAACTTTCCTTGTTTCTAGGG - Intergenic
1152393268 17:80015708-80015730 TCAGAATTTCCTTTCTTTTAAGG - Intronic
1152510806 17:80786296-80786318 ACAAATTTTTCACTTTTTTATGG + Intronic
1152936683 17:83142227-83142249 ACAGAATTTCCTGTTTTTTAAGG - Intergenic
1203165611 17_GL000205v2_random:90234-90256 AACAAATTCCCTTTGTTTTATGG - Intergenic
1153127207 18:1808830-1808852 ATAATTTTTCCTTTTTTGTAAGG + Intergenic
1153631787 18:7077735-7077757 ACATATTTTCCTTTTTCTAAAGG - Intronic
1154011816 18:10580760-10580782 AAAAATCTTGTTTTGTTTTAAGG + Intergenic
1154337264 18:13475645-13475667 ACAAGATTTCTTGTGTTTTAGGG - Intronic
1154956746 18:21265750-21265772 ACAGTTTTTCTTTTTTTTTATGG + Intronic
1155037328 18:22035895-22035917 AGAAATTTAACTTTATTTTAGGG - Intergenic
1155278421 18:24212645-24212667 AAACATTTTCCCTTGTTTGAGGG - Intronic
1155417818 18:25619308-25619330 AAAACATTTCCTTTGTTTAAAGG - Intergenic
1155541377 18:26872024-26872046 TGAAACTTTACTTTGTTTTATGG + Intergenic
1155684641 18:28533631-28533653 ACAATTTTTCCCTCATTTTATGG - Intergenic
1155732697 18:29180685-29180707 CCAAATTTTCCTTTATTTTATGG - Intergenic
1155756995 18:29511256-29511278 ACTCATTCTCCTTTGGTTTATGG + Intergenic
1155823521 18:30408739-30408761 ACTAATTTTCCTCTCTCTTATGG + Intergenic
1156163266 18:34385949-34385971 AGAAAGTTACATTTGTTTTATGG - Intergenic
1156243273 18:35273367-35273389 TCAGATTTTCCTTTCTTTTTAGG + Intronic
1156353853 18:36323945-36323967 AATAATTTTCCCTTTTTTTAGGG - Intronic
1156449060 18:37256247-37256269 ACAAATGTTCCTATGTTGGAAGG - Intronic
1156616456 18:38791452-38791474 ACAAAAATTCCTTTTTTTCAAGG - Intergenic
1156802353 18:41131867-41131889 ACAAATTAACTTTTGCTTTAGGG - Intergenic
1156872128 18:41957429-41957451 AAAAGTTTACCTTTGTGTTAAGG - Intronic
1157032906 18:43934503-43934525 ACTTATTTTCCTTTTGTTTATGG + Intergenic
1157927745 18:51784625-51784647 GTAAATTTTCTTTTGTTTCAGGG - Intergenic
1158011036 18:52728103-52728125 ACAAAATTTATATTGTTTTATGG - Intronic
1158031277 18:52967962-52967984 ACACATTTTACTTTGTTCAATGG + Intronic
1158091140 18:53715057-53715079 CCAAATTTTCCCTTTTTTTAAGG + Intergenic
1158753171 18:60290152-60290174 ACAGATTTTTCTTTATTTCAGGG + Intergenic
1158967056 18:62631573-62631595 TATAATTTTCCTTTGTTTTAGGG + Intergenic
1159062149 18:63527163-63527185 ACAAATTTTCCTTTGTTTGCTGG + Intergenic
1159116071 18:64114523-64114545 AAAAATATTCATTTATTTTATGG + Intergenic
1159280562 18:66279403-66279425 CCAAATTTTGGTTTGTTCTAGGG + Intergenic
1159519441 18:69498864-69498886 ACAAATTTTCCCGTGTATCAGGG + Intronic
1159570518 18:70106540-70106562 ACATAGTTTCCTCTCTTTTAGGG - Intronic
1159679004 18:71323986-71324008 AGATATTTTCCTGTGTTTTCTGG + Intergenic
1160334341 18:78024577-78024599 ACAAGATTTCCTTCTTTTTATGG + Intergenic
1160340298 18:78083718-78083740 AAATTTTTTGCTTTGTTTTAGGG + Intergenic
1160392345 18:78543682-78543704 AAATATTTTCCTTTTTCTTAAGG - Intergenic
1160395586 18:78569341-78569363 TCTAATTTTCATTTGTTTTTTGG - Intergenic
1161820595 19:6528763-6528785 ACAAAAGTCCCTTTATTTTATGG + Intergenic
1161867332 19:6842831-6842853 AGAATTTTTTCTTTTTTTTAGGG - Intronic
1163192772 19:15690649-15690671 AAGAATTTTCTTCTGTTTTAAGG + Intronic
1163200488 19:15764368-15764390 AATAATTTTCTTCTGTTTTAAGG - Intergenic
1163367204 19:16881916-16881938 ACAAATTTTCCTTTGTTTCATGG + Intergenic
1163781509 19:19251873-19251895 AAAAATTTTCCTTTGTTTGCGGG + Exonic
1164140450 19:22456320-22456342 AAATATTCTCCTTTATTTTAAGG - Intronic
1164161883 19:22632287-22632309 ACATTTTTTTGTTTGTTTTATGG + Intergenic
1164404481 19:27931493-27931515 AAAAATTTTCCTTTGTTTTAGGG + Intergenic
1164453632 19:28388449-28388471 ACATAATTTCCTTCTTTTTAAGG + Intergenic
1164662966 19:29994593-29994615 TCAGAATTTCCTTTTTTTTAAGG + Intronic
1164755056 19:30682937-30682959 ACCAATTTTCTTTTATTTTAGGG + Intronic
1165617605 19:37215974-37215996 ACTAATTTTCTTGTGTTTTGTGG - Intronic
1165637021 19:37349150-37349172 CCAAATTTTCCTTGTTTGTAAGG + Intronic
1166246810 19:41534168-41534190 ACAAATTTTCCTTTGTTTTATGG - Intergenic
1166337255 19:42115875-42115897 TCAAATTTTTCTTTCTTGTAGGG - Intronic
1166972748 19:46580896-46580918 ACAAAATTTCCTTCTTTTTAAGG - Intronic
1167453698 19:49587156-49587178 AAAAATTTTCTTTTTTTTTTTGG + Intronic
1167496278 19:49820565-49820587 ACAAATTTTCCTTTGTTTTATGG - Intronic
1168467197 19:56612795-56612817 ACAAATTTCCCTTTTCTATAAGG + Intronic
1168470397 19:56636027-56636049 AAAAATTTTCCATTTATTTAAGG - Intergenic
925236127 2:2279213-2279235 ACAAAACTCCCTTGGTTTTATGG + Intronic
925386141 2:3463208-3463230 ACAAAGTTTCCTTAGGTTGACGG - Intronic
925965316 2:9060209-9060231 AGAAATCTTGCTTTGTGTTATGG + Intergenic
926525096 2:13970689-13970711 TCCATTTTTCCTTTGTTTTTGGG - Intergenic
926557976 2:14381708-14381730 ACAAATTTACATTCTTTTTATGG - Intergenic
926828033 2:16928544-16928566 ACCAAATTTCCTTCTTTTTAAGG + Intergenic
926945491 2:18183341-18183363 ACATATCTTCATTTGTTTCAGGG - Intronic
927132722 2:20074013-20074035 ACAAAATTTCCTTTGTTTTATGG + Intergenic
927226467 2:20770272-20770294 ACAGAGTTTCCTTTGTCTTCTGG - Intronic
928655775 2:33449757-33449779 ATAAATATTCCTTTTTTTTTTGG - Intronic
928728316 2:34201815-34201837 ACATATTTTTCCCTGTTTTAGGG - Intergenic
928873034 2:36004310-36004332 ATCAATTTTACTTTATTTTATGG - Intergenic
928942861 2:36744131-36744153 ACAAAATTTGCTCTTTTTTATGG + Intronic
928988254 2:37202206-37202228 ACAAAAATTACTTTTTTTTAGGG - Exonic
929312830 2:40445405-40445427 AGAAATTTGCCTGTGTTTTCTGG - Intronic
929987406 2:46748485-46748507 ACAAATTTTCCTTTTTCTTATGG + Intronic
930382381 2:50647716-50647738 ACAAACTTTCCTGAATTTTAAGG - Intronic
930457405 2:51622819-51622841 ACTTATTTTACTTGGTTTTAAGG + Intergenic
930471219 2:51816842-51816864 ACTAATTTTACTTTATTTGATGG - Intergenic
931002034 2:57795467-57795489 ACAAGTTTACCTGTGTTTTTCGG - Intergenic
931015403 2:57973273-57973295 ACATATTTTCCTATTTTTAAGGG + Intronic
931101777 2:59010556-59010578 AAAATTTTTCCTTTCCTTTATGG + Intergenic
931259422 2:60604310-60604332 CCAAATTTCCCCTTGTTGTAAGG - Intergenic
931621517 2:64215089-64215111 ACAAAATTGCCTTTATTTGAAGG + Intergenic
932651347 2:73561302-73561324 ACAAATTTTCCTTTGTTTTATGG - Intronic
933064233 2:77773476-77773498 ACACATTTTCCAATATTTTATGG + Intergenic
933066190 2:77800700-77800722 ACAAGCTTTCCTTCTTTTTATGG + Intergenic
933238475 2:79892428-79892450 ACAAATTTTACTCTATTTTGTGG - Intronic
933277070 2:80295221-80295243 ACAAATTTTTTTTTTTTTTGTGG + Intronic
933407991 2:81887137-81887159 TTAAATTTTCTTTTGTTTTATGG - Intergenic
933439719 2:82297280-82297302 ACATTTTTTCGTATGTTTTACGG - Intergenic
933445986 2:82380207-82380229 AAAAATTTTCCTTGGTGTTCAGG + Intergenic
933466704 2:82660251-82660273 AGACATTTCCTTTTGTTTTATGG - Intergenic
933532747 2:83531123-83531145 ACAAATTTTCCTTTGTTTTATGG + Intergenic
934982656 2:98857918-98857940 ATATATTTTGTTTTGTTTTATGG - Intronic
935552838 2:104476966-104476988 AGAAAATTTCCTTTCTTTTAGGG + Intergenic
935572464 2:104676316-104676338 ATATATTTTCCCCTGTTTTAGGG - Intergenic
935643632 2:105314054-105314076 ACAAATTTCCCCTTTTTATAAGG - Intronic
936245591 2:110824052-110824074 AGATTTTATCCTTTGTTTTATGG + Intronic
936658985 2:114521756-114521778 ACAATTTTTCCTCTGTGTTCTGG - Intronic
936743438 2:115544172-115544194 AGAAATTTTCATTTTTATTATGG - Intronic
936956456 2:118027415-118027437 ACAAATTTTACTCTTGTTTAAGG - Intergenic
938226588 2:129621833-129621855 ACAGAATTTCCTTATTTTTAAGG - Intergenic
938723894 2:134090270-134090292 AAAAGTTTTCCTTTATTTAATGG - Intergenic
938872908 2:135499956-135499978 CCAAATTTGCCTTTTTTATATGG - Intronic
938877677 2:135549960-135549982 ATAAATTTTCCTTTGTTCTTTGG + Intronic
939185903 2:138860903-138860925 AGAACTTTTCCTTTGTGTTGGGG + Intergenic
939209892 2:139160813-139160835 ACAGATTTTCCTTTTGTTAATGG - Intergenic
939390470 2:141562661-141562683 ACACTTCTTACTTTGTTTTACGG - Intronic
939751744 2:146056318-146056340 ACAAATTTGCCTTGGTCTTTGGG - Intergenic
939793445 2:146610390-146610412 ACAAGATTTCCTTCATTTTAAGG + Intergenic
939794116 2:146619869-146619891 ACAAGATTTCCTTCATTTTAAGG - Intergenic
940059740 2:149551612-149551634 ACAGAATTTCCTTATTTTTAAGG + Intergenic
940169221 2:150808827-150808849 ACATATTTTTATGTGTTTTATGG + Intergenic
940287478 2:152047011-152047033 TCAAATTTTTCTTTATTTTCAGG - Intronic
940531285 2:154880588-154880610 ACAGAATTTCCTTCTTTTTATGG + Intergenic
940562637 2:155320116-155320138 ACAAAGTTTGCTTTGTTGCAAGG + Intergenic
940673570 2:156701159-156701181 AACAATTTTTCTTTTTTTTAAGG + Intergenic
941220806 2:162778135-162778157 TCCCATTTTCCTTTGATTTATGG - Intronic
941230780 2:162909637-162909659 CCAAACTTTCTTTTGTTTTCTGG + Intergenic
941379984 2:164780431-164780453 ACATATGTTCTTTTTTTTTAAGG + Intronic
941499824 2:166259810-166259832 ACAAATATTTCATTGTTTTTAGG + Intronic
941543279 2:166814026-166814048 ACATATTATCTTTTCTTTTATGG - Intergenic
941590319 2:167411871-167411893 ACAGTATTTCATTTGTTTTATGG - Intergenic
941747808 2:169105834-169105856 CCAAATTTTCCTTTTTATAAGGG - Intergenic
941819883 2:169833711-169833733 AGAAATTTCCTTTTCTTTTAAGG + Intronic
941908445 2:170739366-170739388 TTAAATATTGCTTTGTTTTAGGG - Intergenic
941963038 2:171272601-171272623 AAAAATTTGCCTTTCTTTGAAGG - Intergenic
942128363 2:172850192-172850214 AAAAATTTACCTTTGTTTAAAGG + Intronic
942843398 2:180392566-180392588 ACATATTTTTCTTTGTTGTTAGG + Intergenic
943055603 2:182974500-182974522 TCAAATTTTCCCTTTTTATAGGG - Intronic
943105431 2:183541107-183541129 ATAATTTATCCTGTGTTTTAGGG + Intergenic
943243467 2:185417265-185417287 CCAAGTTTTCCATTGTTTTCAGG - Intergenic
943284132 2:185975633-185975655 TCATATTTTCCTTTGTGTAATGG + Intergenic
943298319 2:186165484-186165506 ACAATTTTTCCTTTGTATTTAGG - Intergenic
943357460 2:186874783-186874805 ACAGATTTTCCTTTTTTAAATGG + Intergenic
943509693 2:188809192-188809214 AAAAATTTTAATCTGTTTTAGGG + Intergenic
943861161 2:192864220-192864242 TCATATGTTGCTTTGTTTTATGG + Intergenic
944012196 2:194985260-194985282 CCAAATTTTCATTTTTGTTAGGG - Intergenic
944033965 2:195270021-195270043 ACAAACTTTTCTTTTTTTTTTGG - Intergenic
944280933 2:197895978-197896000 ATATATTATTCTTTGTTTTAGGG + Intronic
944348537 2:198698760-198698782 AAAAAATTTCCCTTGTTCTAAGG - Intergenic
944820961 2:203430401-203430423 ACAACTATTCATTTTTTTTAAGG - Exonic
944916742 2:204368654-204368676 ACACATTTTCTTTTGATTTCTGG + Intergenic
945407450 2:209467039-209467061 CCAAATTTTCCTTATTTTTAAGG + Intronic
945471940 2:210237434-210237456 CCAAATTTTCCCTTCTTATAAGG - Intergenic
946623503 2:221585299-221585321 ACAGAATTTCCTTCTTTTTAAGG + Intergenic
946806316 2:223474427-223474449 AAAAATTTTGCTCTGTTTCAGGG - Intergenic
947039030 2:225893934-225893956 ACATATTTTGTTTTGTTTTTTGG - Intergenic
947329525 2:229013979-229014001 CCAAATTTTCCTGTTTTATAAGG - Intronic
947667436 2:231915328-231915350 AAAAATTTTGCTTTTTATTAAGG - Intergenic
948085221 2:235241706-235241728 CCAAATTTTCCCTGTTTTTAAGG + Intergenic
948723347 2:239917379-239917401 ACAAATTTTCCTGTCTCTTATGG + Intronic
949052887 2:241906683-241906705 ACAAATTTTCCTTTGTTTTATGG - Intergenic
1169240602 20:3976133-3976155 ATAGATTTTCTGTTGTTTTAAGG + Intronic
1170601145 20:17842738-17842760 ACCAATTTTTGTATGTTTTATGG - Intergenic
1170656421 20:18291071-18291093 ACAACTTTTGTTTTGTTTTGAGG - Intronic
1171029011 20:21659740-21659762 TCAGAATTTCCTTTCTTTTATGG - Intergenic
1171136769 20:22701656-22701678 CCACATTTTCCTTTCTTATAAGG + Intergenic
1172403708 20:34671932-34671954 AAAAATTTTCTTTTTTTATAAGG + Intronic
1172582743 20:36061299-36061321 AGAAATTTCCCATTGTGTTAGGG - Intergenic
1172909260 20:38394411-38394433 CCAAATTTTCCCTTTTTATAAGG - Intergenic
1173491695 20:43487705-43487727 GCAAATTTTCCAAGGTTTTATGG + Intergenic
1173544175 20:43880046-43880068 CCAAATTTTCATCTGTTTTATGG + Intergenic
1173549758 20:43924426-43924448 ACATATCTTCCTGTGTGTTAGGG + Intronic
1173679084 20:44863650-44863672 ACAAATTTTCCTTTGTTTTATGG + Intergenic
1174875109 20:54219253-54219275 AAAAATTTTCATTTATTTAATGG + Exonic
1174978696 20:55365541-55365563 ACATATTTTATTTAGTTTTATGG - Intergenic
1175566398 20:59981737-59981759 AAAAATTTGACTTTGTATTATGG + Intronic
1176406143 21:6368845-6368867 AACAAATTCCCTTTGTTTTATGG + Intergenic
1177067599 21:16460409-16460431 TTAAATATTCCTTTTTTTTAAGG + Intergenic
1177199288 21:17935504-17935526 ACAAATTGTACATTGTTTCATGG + Intronic
1177199842 21:17942160-17942182 ACAAATTATCTTATATTTTATGG - Intronic
1177325099 21:19575726-19575748 ATAAACTTTCCTTTGTCTTCTGG + Intergenic
1177580673 21:23018454-23018476 CCATTTTTACCTTTGTTTTATGG + Intergenic
1177610490 21:23441530-23441552 ACAATTTTTATTTTATTTTAGGG + Intergenic
1177717299 21:24855347-24855369 ATCAATTTTTCTTTTTTTTAAGG - Intergenic
1177909376 21:27011997-27012019 CCAAATTTCCCTTTTTTTTAAGG - Intergenic
1178391596 21:32203299-32203321 ACTAATTTTCTTAAGTTTTAGGG - Intergenic
1178469482 21:32879526-32879548 CCAAATTTTCCTTTGTTATAAGG + Intergenic
1178828692 21:36036844-36036866 ACAAAATTTCCTTTTTTATAAGG - Intronic
1179201118 21:39221961-39221983 ACATTTTTTCCTTTGTTTATTGG - Intronic
1179245766 21:39632848-39632870 AGAAAGTGGCCTTTGTTTTATGG + Intronic
1179337582 21:40472396-40472418 AAAAGTTTTCTTTAGTTTTACGG - Intronic
1179436421 21:41365186-41365208 ACAAATTTTCCTGTTTTATAAGG - Intronic
1180288942 22:10779213-10779235 GAAAATTTTCCTTTGTTAAATGG - Intergenic
1180886782 22:19250917-19250939 CCAACTTTTTATTTGTTTTATGG + Intronic
1181614722 22:24045604-24045626 ACAAATTTTTTTTTTTTTTGAGG - Intronic
1182817933 22:33183663-33183685 ACAAATTTCCTTCTTTTTTATGG - Intronic
1183503839 22:38197579-38197601 CCAAATTTTCTTTTCTTATAAGG + Intronic
1184261236 22:43317882-43317904 CCAAATTTTCCTTTTTTATGAGG - Intronic
1184416719 22:44356161-44356183 TCAAATTTCCCTTTTTTATAAGG - Intergenic
1185145305 22:49131586-49131608 ACAAATTTTCATTTTTTTTTAGG + Intergenic
949407752 3:3732557-3732579 CCAAATTTTCCCTTTTTATAAGG + Intronic
949788271 3:7765351-7765373 ACAAATTTTCAGTTTTTTTAAGG - Intergenic
950920554 3:16689811-16689833 ACAAATTCTCCTATGATTTGTGG - Intergenic
951084956 3:18501454-18501476 AGAACTTTTTCATTGTTTTAAGG - Intergenic
951240314 3:20278807-20278829 CCAAATTTGCTTTTGGTTTAAGG + Intergenic
951352841 3:21627708-21627730 ACACATTTTGCTATGTTTCATGG - Intronic
951355093 3:21656486-21656508 GCAAATTTTCCCTTTTTATAAGG + Intronic
951419188 3:22463658-22463680 GTAATATTTCCTTTGTTTTAGGG - Intergenic
951879648 3:27467580-27467602 ACAGGTTTCCATTTGTTTTACGG - Intronic
952110231 3:30114462-30114484 ACAAAATTTTCTTTTTGTTAAGG + Intergenic
952655032 3:35775598-35775620 ACAAATTTTCCAGTTTTATATGG - Intronic
952787359 3:37168342-37168364 TCAGAATTTCATTTGTTTTAAGG - Intronic
952951350 3:38528005-38528027 ACAAGTTTTCCATTGCTTGAAGG - Intronic
953172376 3:40518918-40518940 ATTAATTTTCCTTTATTTTTTGG + Intergenic
954493947 3:50935124-50935146 ACTAATTTTCTTTTGTTTGTTGG - Intronic
954694697 3:52416166-52416188 ACATATTTTCTTTGGTTTTTTGG + Intronic
955311308 3:57889540-57889562 AAAAATTTTGTTTTGTTTTATGG - Intronic
955471953 3:59295196-59295218 ACATTTTTTCCATTGTCTTAGGG + Intergenic
956386918 3:68729349-68729371 TTAAATTATACTTTGTTTTAGGG + Intergenic
956602387 3:71035748-71035770 ACAAATTGTCCTCTGATTTTTGG + Intronic
956829956 3:73036631-73036653 ACAATTTGTACTTTGGTTTAAGG - Intronic
957214750 3:77305139-77305161 ACGATTTTTCTTTTATTTTAGGG + Intronic
957242738 3:77679710-77679732 ACATAATTTCCTTCTTTTTATGG + Intergenic
957393448 3:79609668-79609690 ACAGAATTTCCTTCTTTTTAAGG - Intronic
957413279 3:79867871-79867893 TAAAATTTTCCTTTTTTTTTTGG + Intergenic
957631198 3:82717519-82717541 AAACATTTTGTTTTGTTTTAGGG - Intergenic
957691986 3:83582539-83582561 ACAAAATTTCATCTCTTTTATGG + Intergenic
957695306 3:83629766-83629788 AGAAATTTTCCTTAGTAATATGG + Intergenic
957991441 3:87632171-87632193 ACAGGATTTCATTTGTTTTATGG - Intergenic
958092626 3:88895585-88895607 ACAAATTTATCTGAGTTTTAGGG - Intergenic
958263254 3:91407329-91407351 TCAAATTGTACTTTGTTTCATGG - Intergenic
958542470 3:95496754-95496776 ATAAATTTTTCTTTATTTTTCGG + Intergenic
958695137 3:97517916-97517938 ACAGAATTTCCTTTTTCTTAAGG + Intronic
959168509 3:102813110-102813132 ATAATTTTTACTTTGCTTTAAGG + Intergenic
959283355 3:104376483-104376505 ACAAAGTTTTATTTGCTTTATGG + Intergenic
959355919 3:105328337-105328359 ACACATTTTCCTGTGATTTCTGG + Intergenic
959601823 3:108195637-108195659 ACAAAATTTCATTCTTTTTATGG - Intronic
959782107 3:110246400-110246422 ACAATTTTTTATTTTTTTTAAGG + Intergenic
959782532 3:110253447-110253469 GCAAGATTTCCTTTTTTTTAAGG - Intergenic
959826485 3:110803191-110803213 ACAAATTTTTCCTTTTTATAAGG - Intergenic
959961260 3:112302035-112302057 ACAAATTTTCCTTTGCTTTATGG + Intergenic
959962314 3:112312457-112312479 ACAAATTTTCCTTTGTTTTATGG + Intergenic
960209433 3:114942217-114942239 ACAAAATTTCCTTTGTATCAGGG + Intronic
960427565 3:117527502-117527524 CCAAATTTCCCTTTTTTATAAGG - Intergenic
960507768 3:118514093-118514115 ACATCTTTTCCTTTTCTTTAGGG + Intergenic
960703604 3:120460697-120460719 ACAGATTTTCATTTGTATTAGGG - Intergenic
960861813 3:122163128-122163150 AGAAAATTGCCTTTGTTTAAAGG - Intergenic
961592708 3:127992630-127992652 ATTTATTTTCATTTGTTTTAGGG - Intergenic
962092237 3:132256538-132256560 TCAAATTTTCCTTTTTTATGAGG - Intronic
962175843 3:133154049-133154071 AAAAATTTTCATGTGTTTTTTGG + Intronic
962433660 3:135345151-135345173 AGTAATTTTTCTTTGATTTACGG + Intergenic
962530857 3:136278293-136278315 ACAGTTTTTCCCTTGTCTTATGG + Intronic
962607974 3:137048537-137048559 CCAAATTTTCCTTTTTTGTAAGG - Intergenic
962757983 3:138482188-138482210 GCAACTTTTCCTTTGTTTATTGG - Intergenic
963184934 3:142404347-142404369 ACAACTTTTCCTTTTGTTAAAGG - Intronic
964276784 3:155017146-155017168 CCAAATTTTCTCTTGTTATAAGG + Intergenic
964410378 3:156391392-156391414 AAAAATTTTCCTTTTGTTTATGG + Intronic
964579453 3:158216610-158216632 ACAATTTTTTGTTTGTTTGATGG - Intronic
964719441 3:159756678-159756700 ACAAATTTTCCAAACTTTTATGG + Intronic
964854561 3:161132464-161132486 TCAAATTTTCCTCTCTTTTGGGG - Intronic
964907094 3:161730308-161730330 CCAAATTTCCCTTTTTTGTAAGG + Intergenic
964964079 3:162468560-162468582 ACAAATATGCCATTGTTTTGTGG - Intergenic
965057416 3:163739847-163739869 AAAAATTTACCTTGCTTTTAAGG + Intergenic
965331007 3:167374725-167374747 ATAATTTTTACCTTGTTTTATGG - Intronic
965605353 3:170492991-170493013 ACAACTTTTCCTTTGTTTGGAGG + Intronic
965609494 3:170529803-170529825 ACAAATTTCCCCTTTTTATAAGG - Intronic
965850190 3:173013829-173013851 ACAAATTTTCCTTTGTTTTATGG - Intronic
966207078 3:177415931-177415953 AATAATTTTCCTTTTGTTTAGGG + Intergenic
966234768 3:177688248-177688270 ACACTTATTGCTTTGTTTTACGG + Intergenic
966501979 3:180652730-180652752 ACAAATTTTCTTTTTTATTAAGG + Intronic
966800633 3:183760720-183760742 AAAATTTTTCCTTTGTATTCTGG + Intronic
966962702 3:184955691-184955713 ACACGTTTTCCTCTGTTTGAAGG + Intronic
967235054 3:187376181-187376203 TCAAATTTCCCTTTTTTATAAGG + Intergenic
967786062 3:193497736-193497758 ACAGAATTTCCTTCTTTTTAGGG - Intronic
967917537 3:194589825-194589847 ACTAATTTGCCTTCGTTTTTGGG + Intronic
968036259 3:195550593-195550615 TAAAATTTTCATTTTTTTTAGGG + Intergenic
968412055 4:398246-398268 AAATATTTTCCTATGTTATAGGG + Intergenic
968536604 4:1134692-1134714 ACAGAATTTCCTTCATTTTATGG + Intergenic
968673979 4:1867157-1867179 CCAAATTTTCCCTTTTTATAAGG + Intergenic
970208770 4:13684882-13684904 TCCAATTTTTGTTTGTTTTAAGG + Intergenic
970466389 4:16327405-16327427 AGACATTTTTCTTTGTTTTCTGG - Intergenic
970759082 4:19461768-19461790 ACAAATTGTACTTCATTTTATGG + Intergenic
971036491 4:22698886-22698908 ACAGAATTTCCTTTTTTTTAAGG - Intergenic
971215721 4:24660699-24660721 AAAAATGCTCCTTTGGTTTATGG + Intergenic
971517690 4:27509192-27509214 CCAAATTTTCCCTTTTTGTAAGG + Intergenic
971717579 4:30199262-30199284 ACAGAATTTCCTCTTTTTTAAGG + Intergenic
971763176 4:30795804-30795826 ACAAATATTACCATGTTTTATGG - Intronic
972072243 4:35036957-35036979 ACAAAATTTCCTTTTTTAAAAGG - Intergenic
972116335 4:35639283-35639305 ACAAATATTTATTTATTTTAAGG - Intergenic
972519660 4:39841509-39841531 ACAAATTTTTTTTTTTTTTTTGG + Intronic
972667747 4:41183514-41183536 CCAAATTTTCCCTTTTTATAAGG - Intronic
972924652 4:43988119-43988141 ACAATTATTCCATTGTTTTGTGG - Intergenic
973090567 4:46131268-46131290 AGTAGTTTTCCTTTATTTTATGG + Intergenic
973146015 4:46827359-46827381 ACATAGTTTCATTTGTTTTTAGG - Intronic
973186759 4:47338852-47338874 ATAAATCTTCCATTTTTTTAAGG + Intronic
973205942 4:47560261-47560283 ATATATTTTCCTTTGTCTTTAGG - Intronic
973283371 4:48386158-48386180 ACAAATTTTCCTTATTTACAAGG + Intronic
973678145 4:53286802-53286824 ACAACTTTAGCTTTGTTTCAGGG - Intronic
974320384 4:60340044-60340066 AAAAATTTTCAGTTGTTTTTAGG - Intergenic
974977458 4:68907568-68907590 ACAAATTTTCCTCTGTTTTATGG - Intergenic
974989279 4:69064321-69064343 ACAAATTTTCCTTTGTTTTATGG + Intronic
974999631 4:69206292-69206314 ACATATTTTTGTTTTTTTTATGG - Intronic
975005242 4:69275182-69275204 ACTAATTTGCTTTTGTTTTTAGG + Intergenic
975049003 4:69836165-69836187 ATATATTTTCTTTCGTTTTAAGG - Intronic
975193852 4:71499754-71499776 ACAGAATTTCCTTTGTTTTATGG + Intronic
975222545 4:71829903-71829925 GCAAAATTTTCTTTGTTTAAAGG + Intergenic
975307024 4:72861599-72861621 AGAAAGTTTCTTTTGTTTTTTGG - Intergenic
975434233 4:74332885-74332907 GAATATTTTCCTTTGTTTTTTGG + Intergenic
975671176 4:76782237-76782259 ACATCTTTTCCTTTGCTCTATGG + Exonic
975986366 4:80203853-80203875 AAAAATGTACCTTTGTTTTGGGG - Exonic
976819734 4:89192033-89192055 TCCAATTTTCCTGTTTTTTAAGG + Intergenic
976864949 4:89713688-89713710 ACAAATTTAGCTTCCTTTTAGGG + Intergenic
977316893 4:95461583-95461605 ACACATTTTCCTATATTTTCTGG + Intronic
977379080 4:96247375-96247397 CCAAATTTTCCATTTTTATAAGG + Intergenic
977468708 4:97414735-97414757 ACAAAGTTTCCTAGGTTTTTTGG + Intronic
977871992 4:102102797-102102819 ACAATTTTTATTTTGTTTTCAGG - Intergenic
978068635 4:104438262-104438284 ACAGAATTTCCTTCTTTTTATGG - Intergenic
978255930 4:106692753-106692775 ACACATTTTCCTTTTTCTTGAGG + Intergenic
978320982 4:107495480-107495502 ACAGAATTTCCTTCTTTTTAAGG + Intergenic
978872623 4:113598438-113598460 AAATATTCTCCTTTGTTTTCTGG - Intronic
978932133 4:114327510-114327532 ATAAATTTTCCTTGGGTTGAAGG - Intergenic
979021148 4:115500255-115500277 ACAAATTTTACATTTTTTAATGG - Intergenic
979137920 4:117133317-117133339 AAAAATTCTACTTTATTTTATGG - Intergenic
979915636 4:126429921-126429943 TCAAATTTTCCTTTGTTGCTGGG - Intergenic
980102868 4:128559060-128559082 AAACATTTCCCTTTGTTTTGAGG - Intergenic
980233047 4:130068457-130068479 CCAAATTTTCCTTTTTTCTTTGG + Intergenic
980307321 4:131079217-131079239 ACAGACTTACCTTTTTTTTAAGG + Intergenic
980414756 4:132471817-132471839 AAAAATATTCCTTTGTATGAAGG - Intergenic
980514076 4:133830981-133831003 ACAAAATTTCATTCTTTTTATGG - Intergenic
981204426 4:142022136-142022158 ATAAAGATTCCTGTGTTTTAAGG - Intergenic
981748987 4:148075466-148075488 CCAAATTTCTCCTTGTTTTAAGG - Intergenic
981830762 4:148998504-148998526 ACAAATCTTCCCATCTTTTAGGG + Intergenic
981868421 4:149456140-149456162 ACAAATTTTCCTGTTTCTTTGGG - Intergenic
981877952 4:149571309-149571331 ACAGAATTTCCTTCCTTTTATGG - Intergenic
981951783 4:150418403-150418425 AAAAATTCTTGTTTGTTTTATGG - Intronic
981992487 4:150939316-150939338 ACAAATTTTCCCTCTTTATAAGG - Intronic
982417590 4:155155170-155155192 ACTAAATTTTCCTTGTTTTAGGG + Intergenic
982924264 4:161316264-161316286 ACAAAATGTCTTTTGGTTTACGG + Intergenic
983278037 4:165642707-165642729 TTAAATTTTCCTTTATTTTCTGG + Intergenic
983364014 4:166763243-166763265 AGAAATTTTCCATTGTCTTCTGG - Intronic
983364865 4:166773254-166773276 AAAGATTTTCCTTTATTTTCCGG - Intronic
983524140 4:168743217-168743239 ATAAATATTTCTTTGTTTAATGG + Intronic
983600665 4:169523384-169523406 TCAAATTTTCCCTTTTTATAGGG - Intronic
983744228 4:171175507-171175529 ACCAATTTACCTGTATTTTAAGG + Intergenic
983845873 4:172516848-172516870 ACAGAATTTCCTTCCTTTTAAGG - Intronic
983857643 4:172665171-172665193 ACACATTTTAGGTTGTTTTAAGG + Intronic
984167973 4:176325656-176325678 AACAATTTGCCTTTGTTTTAGGG + Intronic
984178958 4:176456854-176456876 ACATTTTTTCATTTGTTTTTTGG - Intergenic
984311027 4:178058524-178058546 GCTACTTTTCCTTTGTTTAAAGG + Intergenic
984324379 4:178233393-178233415 ACAAGTTTTTCTTTTTTTTATGG + Intergenic
984398943 4:179237269-179237291 ACAATTTTTCTCTTGTTATAGGG - Intergenic
984568704 4:181363760-181363782 ACAAATTATCCTCTTTGTTATGG - Intergenic
985190393 4:187366400-187366422 ATAAATTTTCCTTTGTATGGGGG - Intergenic
985798010 5:1978854-1978876 CCAAATTATCCATTGTTTTGTGG - Intergenic
985886360 5:2683026-2683048 CCAAATTTTTCATTCTTTTACGG + Intergenic
985982815 5:3486435-3486457 CCAAATTTTATTCTGTTTTATGG - Intergenic
986342400 5:6801956-6801978 ACACAGGTTCCATTGTTTTAAGG - Intergenic
986344876 5:6825232-6825254 TCTAATTTTCCCTTTTTTTATGG + Intergenic
987281393 5:16417484-16417506 TCTAACTTTCCTTTGTTTTCTGG - Intergenic
987504975 5:18756291-18756313 TGAAATTTTTCTTTGTTTTCTGG - Intergenic
987549588 5:19361312-19361334 CCAAATTTTCATGTTTTTTAAGG + Intergenic
987714865 5:21554873-21554895 ACAAATTTTCCTTTGCTTTATGG - Intergenic
987900083 5:23999764-23999786 AAAAATTTTCATTTCTTTTTAGG - Intronic
987992773 5:25236479-25236501 ACAGAATTTCCTTCCTTTTAAGG + Intergenic
988009925 5:25468610-25468632 ATAAATTTCCCTTTGGGTTAAGG - Intergenic
988040850 5:25887707-25887729 ACTAATTTTTTTTTTTTTTAAGG - Intergenic
988071714 5:26298382-26298404 ACACAATTTAATTTGTTTTAAGG + Intergenic
988161454 5:27522923-27522945 AAAAATTTTGTTTTGTTTTAAGG - Intergenic
988333062 5:29868191-29868213 ACATATTTTCTTCTGTTTTGTGG - Intergenic
988352951 5:30135657-30135679 TCAAATTTTCTTTTGTTCTGTGG - Intergenic
988356413 5:30181954-30181976 ACAAATGTCCCTTTGGTTAAAGG + Intergenic
988409758 5:30871892-30871914 AAAAATTTTTTTTTGTATTAAGG - Intergenic
988425875 5:31063811-31063833 AAAAATATTTCTTTGCTTTATGG + Intergenic
988671190 5:33383896-33383918 ACAATCTTTCCTTTGTTATAGGG + Intergenic
988716488 5:33834124-33834146 CCAAATTTTCTCTTGTTATAAGG + Intronic
988882546 5:35518963-35518985 ACAAATTTTCTATTGTCTGAAGG - Intergenic
988980040 5:36558643-36558665 ACAAGATTTCCTTTTTTTAAAGG - Intergenic
989316382 5:40084249-40084271 TCAAAATTTCCTTCCTTTTAAGG - Intergenic
989379125 5:40796952-40796974 ACATATTTGACTTTGTTATAAGG - Intronic
989444769 5:41514510-41514532 AAGAATTTTTCTGTGTTTTAAGG + Intergenic
989646128 5:43634625-43634647 ATAAAGTTTCATTTGTTTTGAGG + Intronic
989974480 5:50567164-50567186 ACAAATTTTGCTTTGGTAGAAGG - Intergenic
990345772 5:54869775-54869797 ACCAATTTTCCTTTCTTAGATGG + Intergenic
990618969 5:57539516-57539538 ACAAGTTTTACTTAGTTTTCAGG + Intergenic
991235656 5:64393393-64393415 ATAAATTTTCATTTTTTTTCTGG - Intergenic
991547706 5:67801726-67801748 ACAGAATTTCCTTCGTTTTAAGG - Intergenic
991624486 5:68585862-68585884 CCAAATTTTCCCTTTTTATAGGG - Intergenic
991668041 5:69019625-69019647 ACAAATTTCCCTTGATTATAAGG + Intergenic
992095083 5:73355607-73355629 TCTAATTTTCCTTAGTCTTATGG + Intergenic
992528483 5:77633333-77633355 ACAAATTTTTTTATGTTTCATGG + Intronic
992533531 5:77674434-77674456 ACAGATTTGTCTTTCTTTTATGG + Intergenic
992558658 5:77928685-77928707 ACAAACTTTCTTTTGTTGTTGGG + Intergenic
992862531 5:80926749-80926771 ACAAATGTTACTTTGTTATGAGG + Intergenic
992946224 5:81813313-81813335 AGAAATTGTCCTTTATTCTATGG + Intergenic
993258079 5:85619019-85619041 ACAAGTTTTTCTTTGTTTTATGG - Intergenic
993361247 5:86979249-86979271 CCAAATCTTCATGTGTTTTAAGG + Intergenic
993597211 5:89872443-89872465 AAAAATTATTCTTTGTTTCAGGG - Intergenic
993642434 5:90421506-90421528 AACAATTTTCCTATATTTTAGGG - Intergenic
994163210 5:96580139-96580161 ACTCACTTTCCTTTGTCTTATGG - Intronic
994207251 5:97049097-97049119 ACAATTTTGCATTTGTTTTTAGG + Intergenic
994552268 5:101251450-101251472 ACAAATTTTATTTTTTATTATGG - Intergenic
994566519 5:101453473-101453495 ACAAGATTTCCTTCTTTTTAAGG - Intergenic
994908992 5:105877238-105877260 ACCTATTTTCCTTTGTATTCTGG - Intergenic
995177280 5:109193430-109193452 CCAAATATTCATTTGTTTTGAGG - Exonic
995576324 5:113539329-113539351 CCAAATATTCCTTTGCTTTCTGG + Intronic
995592203 5:113711409-113711431 ACAAGATTTCCTTCTTTTTATGG + Intergenic
995902628 5:117087937-117087959 ACAAATTTTTTTTTGGTTTTTGG + Intergenic
996357042 5:122606536-122606558 ACAGATTTTTCTTTCCTTTAGGG + Intergenic
996371496 5:122757907-122757929 CCAAATTTTCCCTTTTTATAAGG - Intergenic
996376733 5:122817406-122817428 AAATATTTTCATTAGTTTTATGG - Intronic
996452243 5:123638522-123638544 ACAGAATTTCCTTCTTTTTATGG - Intergenic
996506607 5:124275257-124275279 CCAAATTTTCCATTTTTGTAAGG + Intergenic
996785541 5:127233040-127233062 AGCAATTCTCCTGTGTTTTAAGG - Intergenic
996833748 5:127768326-127768348 CCAAATTTTCATTTTTTATAAGG - Intergenic
997122702 5:131192098-131192120 ACAAGATTTCCTTGTTTTTATGG - Intronic
997756616 5:136405757-136405779 CCAAATTTTCCAAAGTTTTATGG - Intergenic
998586813 5:143435603-143435625 ACAAATTTTATTTTGATTTTAGG + Intergenic
998631347 5:143902059-143902081 ACAAATGTGCCTTTGGATTACGG + Intergenic
998922436 5:147084462-147084484 ACAAATTTTCCTTTCTATGTTGG - Intronic
999397134 5:151236861-151236883 ACAAGATTTCCTTCTTTTTAAGG - Intronic
999427164 5:151498274-151498296 ACACACTTTCCTTTGTTCCATGG - Intergenic
999945074 5:156586916-156586938 ACATATTTTTCTTTATTTTGGGG + Intronic
1000125951 5:158244291-158244313 ATACATTTTCATTTTTTTTAAGG + Intergenic
1000215860 5:159155333-159155355 ATAAATTTTGCTTTGTTGTTAGG - Intergenic
1000748500 5:165065822-165065844 ACAAATTTCCCCTTTTTATAAGG + Intergenic
1002678540 5:180940030-180940052 TTATATTTTCATTTGTTTTAAGG - Intronic
1002756214 6:162728-162750 ACAGGATTTCCTTTGTTTTAAGG - Intergenic
1003228106 6:4224592-4224614 ACAAATTTTCCTCTGTTTTATGG + Intergenic
1003409805 6:5852034-5852056 AGACATATTCCTTTATTTTAGGG - Intergenic
1003815243 6:9832906-9832928 TCAAATTTCCCTTTTTTATATGG - Intronic
1003908389 6:10722590-10722612 CCAAATATCCGTTTGTTTTAGGG - Intergenic
1003911365 6:10747228-10747250 CCAAATATCCGTTTGTTTTAGGG - Intergenic
1003968546 6:11277080-11277102 ACTAATTTTCATTTGTAATATGG + Intronic
1004078318 6:12365812-12365834 TTAACTTTTCCTTTGGTTTATGG + Intergenic
1004195614 6:13501475-13501497 TCCAATTTTACTTTGTTTTAGGG - Intergenic
1004494867 6:16154145-16154167 ATTAATTTTTCTTTTTTTTAAGG + Intergenic
1004569722 6:16833511-16833533 ATAAATATTCCTTTGGATTAAGG - Intergenic
1004845868 6:19641118-19641140 ACAAATTTTCCTTTAACTTTCGG - Intergenic
1005092242 6:22069879-22069901 AAAAATTTGCATTTGTGTTAAGG + Intergenic
1005137713 6:22590026-22590048 ACCAATTTTCTTTTGTTCTGGGG - Intergenic
1005172113 6:22999561-22999583 ACAAAATTTAATTTGTTTGAAGG + Intergenic
1005316796 6:24610773-24610795 ACAATTTTTTTTTTGTTTTGAGG - Intronic
1005771254 6:29074740-29074762 TTAAATTTTCCTTTGGTTAAAGG - Intronic
1005854320 6:29849148-29849170 ACAGAATTTCCTTCTTTTTAAGG - Intergenic
1006238966 6:32661027-32661049 TGACAATTTCCTTTGTTTTAGGG - Intronic
1006888444 6:37402008-37402030 ACAAATTTTCCTTTGTTTTATGG - Intergenic
1007088956 6:39169967-39169989 ACAGAGTTTCCCTTGTTGTACGG - Intergenic
1007659797 6:43477139-43477161 CCAAATTGTCCTTTGTTTTCAGG - Intergenic
1008102540 6:47407443-47407465 ACAAATTTTGCTTTGTCATATGG + Intergenic
1008660734 6:53665041-53665063 ACAAATTTTTTTTTTTTTTTAGG + Intronic
1008717280 6:54304425-54304447 ACAACATTTCCTTATTTTTAAGG - Intergenic
1008992153 6:57615548-57615570 TCAAATTGTACTTTGTTTCATGG + Intronic
1009000441 6:57706571-57706593 TCACATTTTCTTTTTTTTTAAGG - Intergenic
1009001852 6:57727168-57727190 ACAAATTTTCCTTTGCTTTATGG + Intergenic
1009324567 6:62334611-62334633 CTAAATTTTATTTTGTTTTATGG + Intergenic
1009513357 6:64581433-64581455 AAAGTTTTTCCTTTGTTTTATGG + Intronic
1009627251 6:66150607-66150629 TCAGAGTTTCCTTTTTTTTAAGG + Intergenic
1009638141 6:66293790-66293812 ATCAATTTGCCTTTATTTTATGG + Intergenic
1009944776 6:70330583-70330605 ACCAATTTTTCTTTTTTTTTAGG + Intergenic
1009963577 6:70554165-70554187 ACAAAACTTACTTTGTTTTCAGG - Intronic
1010174526 6:73012281-73012303 TCAAAATTTCCTTCTTTTTAAGG - Intronic
1010291486 6:74142887-74142909 ACAAATTTCCCTGTGATTTCAGG + Intergenic
1010441305 6:75898183-75898205 AAAAATTTTTCTGTGTGTTACGG + Intronic
1010809558 6:80284830-80284852 ACACATTTTCATTTCTTTTCTGG + Intronic
1010972395 6:82276750-82276772 TCAAACTTTCCTTTCTTTTAAGG - Intergenic
1011056663 6:83212024-83212046 ACAAATGCTTCTTTGTTTTGCGG + Exonic
1011408534 6:87041623-87041645 ACAACCTTTCCTTTGTGTTTGGG + Intergenic
1011410541 6:87061657-87061679 AGAAGTTTTGCTTTGTTTTGGGG - Intergenic
1011650147 6:89498568-89498590 CCAAGTTTTGTTTTGTTTTAAGG + Intronic
1011724290 6:90193335-90193357 CCAAATTTTCCCTTTTTATAAGG - Intronic
1011738564 6:90336655-90336677 ACAATGCATCCTTTGTTTTAGGG + Intergenic
1012260201 6:97079736-97079758 ATTTATTTTCCTTTGGTTTAGGG - Intronic
1012289992 6:97442359-97442381 ACAAATTCTCATTTGTTTTCAGG + Intergenic
1012338878 6:98093339-98093361 TCAAATTTTATTTTATTTTAGGG + Intergenic
1012877555 6:104746225-104746247 ACAAAAACTCTTTTGTTTTAAGG + Intronic
1013212876 6:108002281-108002303 TAAAATTTTATTTTGTTTTATGG - Intergenic
1013938376 6:115628557-115628579 ACAAATAATCCTTTGTAGTAAGG - Intergenic
1014079293 6:117269389-117269411 ACAAATTTTCATTTGTCTTTGGG + Intronic
1014335892 6:120136232-120136254 ACATATTTTCATATGCTTTAGGG - Intergenic
1014365954 6:120542191-120542213 ACAAATTTCCCCTTTTTATAAGG + Intergenic
1014549096 6:122768097-122768119 ACATATTTTCATATGTTTAATGG - Intergenic
1015058415 6:128932533-128932555 TCAATTTCTCCTTTTTTTTAGGG - Intronic
1015128384 6:129781430-129781452 ACAAACTGTCATTTTTTTTATGG + Intergenic
1015354861 6:132265777-132265799 ACAGAATTTCCTTCTTTTTAAGG + Intergenic
1015771737 6:136775035-136775057 ATAAATTTTGATTTGCTTTAAGG - Intronic
1015792514 6:136978285-136978307 TATAATTTTCCTTTATTTTAAGG + Intergenic
1015806973 6:137119489-137119511 ACAAATTTTCCTTTCTCTTATGG + Intergenic
1016116335 6:140290515-140290537 ACTTGGTTTCCTTTGTTTTAGGG - Intergenic
1016148670 6:140708138-140708160 ACAAATTTTGTTTGGTTCTAGGG + Intergenic
1016508885 6:144817419-144817441 ATACATTTTTCTTTTTTTTAAGG - Intronic
1016719235 6:147274183-147274205 CCAAATTATTCATTGTTTTAAGG - Intronic
1016733614 6:147452506-147452528 AAAAAATTCACTTTGTTTTAAGG + Intergenic
1017668121 6:156741642-156741664 AATAATTTTCCTTTGCTTCATGG + Intergenic
1017930373 6:158948777-158948799 ATAAATTTTCTTTAGTATTAGGG + Intergenic
1018004879 6:159612574-159612596 ACACATTTTCCTGTGTCTTGGGG + Intergenic
1018707871 6:166476102-166476124 CCAAATTTCCCCTTGTTCTAGGG - Intronic
1020513330 7:9087142-9087164 CCAAATTTTCCCTTCTTATAGGG + Intergenic
1020592627 7:10160640-10160662 CCAAATTTTCTATTTTTTTAAGG + Intergenic
1020627933 7:10605943-10605965 ACAAGATTTCCTTCTTTTTAAGG + Intergenic
1020919701 7:14247159-14247181 ACAAAATTTCCTTCTTTTTAAGG + Intronic
1020971749 7:14952093-14952115 CCAAATTTTCCTTTTTTGTAAGG - Intronic
1021088777 7:16455941-16455963 ACAAATTTGCCAATGTTGTAAGG + Intergenic
1021139837 7:17010717-17010739 ACAATTTTTATTTTGTTTTTGGG + Intergenic
1021197702 7:17691338-17691360 ACAATTCTTCCTTTCTTTCATGG + Intergenic
1021415133 7:20375358-20375380 TCTAATTTTCCTTTTTTTTTTGG - Intronic
1021644050 7:22770571-22770593 TCAGAATTTCCTTCGTTTTAAGG - Intergenic
1021764832 7:23938355-23938377 ACAAATATTTGTTTGTTTAATGG + Intergenic
1021815435 7:24442862-24442884 ACTAATTTTCCTTAGTTTCCAGG - Intergenic
1021912246 7:25397634-25397656 AAACATTTTGTTTTGTTTTATGG + Intergenic
1022423338 7:30245269-30245291 ACTAATGTTCCCTTGTTCTATGG - Intergenic
1022568627 7:31428726-31428748 ACAGAATTTCCTTCGTTTCATGG + Intergenic
1022674067 7:32481960-32481982 ACAAATTTTCCTTCGTTTTATGG + Intergenic
1022799974 7:33767447-33767469 ATATATTTTTCTTTGTTTTAAGG + Intergenic
1023483895 7:40664001-40664023 CCAAATTTTCCCTTTTTATAAGG - Intronic
1023926288 7:44672225-44672247 GCAAAGTTTGCTTTGTTTCATGG + Intronic
1024116086 7:46195317-46195339 ATTAATTTTCCTTTATTTTTTGG - Intergenic
1024127314 7:46312818-46312840 ACAAAATTTCGTTCTTTTTATGG + Intergenic
1024423617 7:49200010-49200032 ACAAATTTTCCTTTGTTTTATGG + Intergenic
1024845397 7:53636297-53636319 GCAAATTTTCCAATATTTTATGG - Intergenic
1024887784 7:54164056-54164078 ACAATTTCTCCTTTATTGTAAGG + Intergenic
1025281831 7:57631799-57631821 TCAAATTTCCCTTTCTCTTATGG + Intergenic
1025302898 7:57833718-57833740 TCAAATTTCCCTTTCTCTTATGG - Intergenic
1025765094 7:64437564-64437586 CCAAAGTTTTCTTTGTTGTAAGG + Intergenic
1025774094 7:64543411-64543433 ACTGATGTTCCATTGTTTTAGGG - Intronic
1025970226 7:66316572-66316594 TCAAATTTTGCTTTATTTTGAGG + Intronic
1026581129 7:71618143-71618165 ACATAATTTCATTTGTTTTATGG + Intronic
1026748788 7:73033521-73033543 AATCATTTTTCTTTGTTTTAAGG - Intergenic
1026752436 7:73061666-73061688 AATCATTTTTCTTTGTTTTAAGG - Intergenic
1026756087 7:73089793-73089815 AATCATTTTTCTTTGTTTTAAGG - Intergenic
1026975900 7:74498087-74498109 ACATCTTTTCATCTGTTTTATGG + Intronic
1027034984 7:74918787-74918809 AATCATTTTTCTTTGTTTTAAGG - Intergenic
1027091318 7:75303636-75303658 AATCATTTTTCTTTGTTTTAAGG + Intergenic
1027094962 7:75331607-75331629 AATCATTTTTCTTTGTTTTAAGG + Intergenic
1027225699 7:76242485-76242507 AAAAATTTTCTTTTTTTTTTGGG - Intronic
1027292357 7:76728385-76728407 ATAAATTTTCCTTTTCCTTAAGG + Intergenic
1027324377 7:77036067-77036089 AATCATTTTTCTTTGTTTTAAGG - Intergenic
1027837069 7:83258004-83258026 GCACATTTTCCTCTATTTTAGGG - Intergenic
1027982380 7:85242035-85242057 ACAAATTTCTTTTTTTTTTATGG - Intergenic
1028003113 7:85526551-85526573 AAAAGATTTCCTTTGTTTCATGG + Intergenic
1028026519 7:85848871-85848893 AAAAATTTTGCTTTTTTCTAGGG - Intergenic
1028210785 7:88071866-88071888 ATAAAATTTCCTTTATGTTAAGG + Intronic
1028259601 7:88645672-88645694 ACAAACTTTCCATTTTTATAAGG - Intergenic
1028311216 7:89339169-89339191 ACAAATTATCTTTTATTTAAAGG - Intergenic
1028552040 7:92079004-92079026 GAAAATTTTACTTTATTTTAGGG - Intronic
1028555027 7:92113842-92113864 ATAACTTTTTCTTTTTTTTAGGG - Exonic
1028726929 7:94098368-94098390 ACAACTTTTGCTTTGTTTTCAGG - Intergenic
1028960412 7:96742801-96742823 ACGAATTTTTGTTTGTTTGATGG - Intergenic
1029395072 7:100302343-100302365 AATCATTTTTCTTTGTTTTAAGG + Intergenic
1030002683 7:105082164-105082186 GAAAATTTTCTTTTGTTTTGAGG - Intronic
1030176151 7:106657000-106657022 AAAAGTTTTTCATTGTTTTAAGG - Exonic
1030222784 7:107114711-107114733 GCAAATTTTTATTTGTTTGAAGG + Intronic
1030414885 7:109230527-109230549 ACAAATTTTTCCTTTTTATATGG + Intergenic
1030418057 7:109270361-109270383 ACAGAATTTCCTTCCTTTTATGG + Intergenic
1030555405 7:111018421-111018443 AGAAACTGTCCTGTGTTTTAGGG - Intronic
1030636941 7:111960852-111960874 ACAGAGTTTCCTTCTTTTTAAGG + Intronic
1030681442 7:112438599-112438621 ACAAATTTGCCTTTGTCTCCAGG - Intronic
1030784803 7:113645989-113646011 ACATATTTCCCATTGTCTTAGGG + Intergenic
1031063203 7:117075322-117075344 ACAATTTTTATTTTGTTTCATGG + Intronic
1031356022 7:120787913-120787935 ACAAATTTTCCTTTTCATAATGG + Exonic
1031431185 7:121671488-121671510 ACAAATTGTCCTTTGCTGCAGGG - Intergenic
1031433616 7:121705285-121705307 ACAGAATTTCCTTCTTTTTATGG - Intergenic
1031447087 7:121868190-121868212 GAAAATTTTCATTTGTTGTATGG - Intergenic
1031464057 7:122086212-122086234 ACAGCTGTTCCTTTCTTTTAGGG + Intronic
1031565139 7:123286980-123287002 ACAGAATTTCCTTCTTTTTATGG + Intergenic
1031901901 7:127419939-127419961 CCAAATTTTCATTTCTTATAAGG - Intronic
1032202228 7:129830120-129830142 ACACTATTTCCTTTGTCTTAAGG + Intergenic
1032565611 7:132939668-132939690 CCAAATTTTCGTTTGTTCAAAGG - Intronic
1032670494 7:134077919-134077941 ACAAATTTTCCTTTGTTTTATGG - Intergenic
1032996254 7:137449950-137449972 ACAGGATTTCCTTTTTTTTATGG - Intronic
1033250623 7:139755468-139755490 ACAAATTGTTTTTTGTTTCATGG - Intronic
1033569958 7:142617983-142618005 AGATGTTTTCCTTTGTTGTACGG - Intergenic
1033714809 7:143989252-143989274 ACAAATTTTCTTTTCTCTTATGG + Intergenic
1033952981 7:146808870-146808892 ACAGAATTTCCTTCTTTTTATGG + Intronic
1034101616 7:148456001-148456023 ACTATTTTTCTTTTGTTTAAAGG - Intergenic
1034209366 7:149349390-149349412 ACAAATTTTCCAACCTTTTATGG + Intergenic
1034472936 7:151265251-151265273 CCAAATTTCCCTTTCTTGTAAGG - Intronic
1034593018 7:152159772-152159794 GAAAATATTCCTGTGTTTTAAGG - Intronic
1035786922 8:2268831-2268853 AAAAATTTTTTTTTTTTTTAAGG - Intergenic
1035805885 8:2452885-2452907 AAAAATTTTTTTTTTTTTTAAGG + Intergenic
1036178100 8:6558434-6558456 ACAAAATTTCAATTATTTTATGG + Intronic
1036395136 8:8363225-8363247 TCAAAGTTTCCTTTTTATTAAGG - Intronic
1036428104 8:8664972-8664994 ACAAATTTCCTTTGCTTTTACGG - Intergenic
1036458236 8:8928404-8928426 AAAAATTTTTATTTCTTTTAAGG - Intergenic
1036781738 8:11652497-11652519 TCAAATTTTCCTTCCTTTTAAGG + Intergenic
1036918526 8:12829511-12829533 ACATATTTTTCTTTATTTTCTGG - Intergenic
1036948471 8:13118412-13118434 ACAAATTGTCATTTTTTTTTAGG - Intronic
1037074114 8:14691615-14691637 TCAAATATTCCTTTTTTTTTAGG - Intronic
1037407677 8:18561295-18561317 ACAGAATTTCCTCTTTTTTAAGG - Intronic
1038330401 8:26603808-26603830 TCAGAATTTCCTTTTTTTTATGG + Intronic
1038590430 8:28832415-28832437 ACACTTTCTCCTGTGTTTTAAGG - Intronic
1038624357 8:29176487-29176509 ACAATTTTTGCTTTGTACTATGG - Intronic
1038696273 8:29809492-29809514 AGAAATTTAGTTTTGTTTTAGGG + Intergenic
1039106430 8:33994918-33994940 TCAAATTTCCCTTTCTTATAAGG - Intergenic
1039140026 8:34376439-34376461 ACAAATTTTCATGCGTTTTGAGG - Intergenic
1039500576 8:38013543-38013565 ACAAATTTTCCTTTGTTTTATGG - Intergenic
1039533831 8:38289538-38289560 ATCAATTTTCCTTTGGTTTTTGG - Intronic
1040924717 8:52667289-52667311 TTAACTTTTCCTTTTTTTTAAGG - Intronic
1041269658 8:56099032-56099054 ACTAATTTTCTTTTTTTTAATGG + Intergenic
1041316631 8:56570182-56570204 AAACTTTTTCCTTTATTTTATGG - Intergenic
1041507352 8:58614316-58614338 ACAAATTTTCCTTTGTTTTATGG + Intronic
1041593853 8:59623106-59623128 ATTATTTTTCCTTTGTTTAACGG - Intergenic
1041596580 8:59661095-59661117 CCAAATTTTCCCTTCTTGTAAGG - Intergenic
1041886846 8:62819424-62819446 ATAAATTTTACTTTTTATTATGG - Intronic
1042075993 8:64995353-64995375 ACAATTTTTCCTCTGTATAATGG - Intergenic
1042110341 8:65374993-65375015 ACACATTCTCTGTTGTTTTAAGG - Intergenic
1042126534 8:65543056-65543078 ACAGATTTTCCTTTAGTTAACGG - Intergenic
1042386900 8:68187026-68187048 ACAACTTTTTTTTTTTTTTAAGG + Intronic
1042423844 8:68623454-68623476 CCCAATGTTCCCTTGTTTTAAGG + Intronic
1042775651 8:72427934-72427956 TCAAATTTTCCTTTTATTTATGG + Intergenic
1042775773 8:72429325-72429347 CCAAATTTTCCCTTTTTATAAGG - Intergenic
1042800215 8:72710221-72710243 ACCAATGTTCCTTTGTGTTAGGG - Intronic
1043574386 8:81641186-81641208 ACAAAATGACATTTGTTTTAAGG - Intergenic
1043626290 8:82263751-82263773 AAAAATTTTCCTGTGTTTTGGGG + Intergenic
1043699090 8:83261486-83261508 CCAAATTTTCCCATGTTTCAGGG - Intergenic
1044270122 8:90232065-90232087 ACATATTTTCATTTGTTTTCTGG + Intergenic
1044356883 8:91233126-91233148 ATAAATTATCCTCTGTTTGATGG - Intronic
1044408509 8:91858736-91858758 ACAATTTTTCTTTTGTTATTAGG - Intergenic
1044439675 8:92208792-92208814 AATAATTTTCCTTTGTGTTGTGG - Intergenic
1044689226 8:94860606-94860628 ACATGTTTTACTTTGTTTTTTGG - Intronic
1045378976 8:101604037-101604059 ACACACTTCCCATTGTTTTATGG - Intronic
1046266378 8:111836649-111836671 AAAAATTTTCAGTTGTATTAAGG + Intergenic
1046310629 8:112432308-112432330 ACTTATTTTACTTTATTTTAGGG + Intronic
1046315023 8:112488840-112488862 ACAGATCTTCCTATGTTATATGG + Intronic
1046425355 8:114041215-114041237 ACAATATTTCCTTATTTTTATGG - Intergenic
1046658653 8:116924736-116924758 ACAAATTTTCCTTTGTTTTATGG - Intergenic
1047343703 8:124006933-124006955 CCAAATTTTGCTTTGTCTCAAGG - Intronic
1047398829 8:124528829-124528851 ACAAATTTTCCTTTGCTTTATGG + Intronic
1047666151 8:127093560-127093582 ACTAATTCTCTCTTGTTTTAGGG - Intergenic
1048094099 8:131272675-131272697 ACAAGGTTTCCTTCTTTTTAAGG - Intergenic
1048266807 8:132994499-132994521 AGAAGATTTCCTTAGTTTTATGG + Intronic
1048269672 8:133018525-133018547 ACAAGTTTTTTTTTTTTTTAGGG + Intronic
1048275051 8:133059594-133059616 ATAAGGTTTCCTTTGTTTTCAGG + Intronic
1048382213 8:133875786-133875808 GCAAATTTTCATTTGTTTGTTGG + Intergenic
1048567011 8:135611640-135611662 CCAAATTTTCTTTTCTTTGAAGG + Intronic
1048924887 8:139262651-139262673 ACAGTTTTTCCTGTGTTTTTTGG - Intergenic
1049977961 9:877809-877831 ATTATTTTTCCTTTATTTTAGGG + Intronic
1050110015 9:2205440-2205462 AAAAATTTTCTTTTTTTTTCTGG - Intergenic
1050571352 9:6942650-6942672 GCAAGTCTTTCTTTGTTTTAGGG + Intronic
1051134277 9:13900676-13900698 ATAAATATTCCATTGTTTTGAGG - Intergenic
1051299835 9:15636911-15636933 ACGAATTTTTTTTTGTTTTTAGG + Intronic
1051347407 9:16164677-16164699 GCAAATTTTCCTTTTTTATAAGG - Intergenic
1052014188 9:23445951-23445973 AATAATCTTCTTTTGTTTTAAGG + Intergenic
1052228608 9:26119953-26119975 ACAAAATTTACTTTGTAGTAAGG - Intergenic
1052398319 9:27969194-27969216 GGAAATTTAACTTTGTTTTATGG + Intronic
1052430074 9:28354298-28354320 ATTAATTTTGCTTTATTTTATGG + Intronic
1053598012 9:39583827-39583849 CCATTCTTTCCTTTGTTTTAAGG + Intergenic
1053856038 9:42340836-42340858 CCATTCTTTCCTTTGTTTTAAGG + Intergenic
1054860569 9:69948741-69948763 CCAAATTTTCCTTTTTTATAAGG - Intergenic
1054871723 9:70053254-70053276 AGAAATTTGCATGTGTTTTATGG + Intronic
1055008989 9:71542641-71542663 CCAAACTTTCCTTAATTTTAAGG + Intergenic
1055113520 9:72583656-72583678 ACATATTTTCCTTTGTGCTTTGG + Intronic
1056006605 9:82278439-82278461 CCAAATTTTCTTTTCTTTAAAGG + Intergenic
1056871490 9:90285482-90285504 ATACATTTTCCTTTCTCTTAGGG - Intergenic
1057617906 9:96608532-96608554 TCTAATTTTCCATTCTTTTATGG - Intronic
1058216986 9:102246830-102246852 TCAAATTTTCTTTTCTTATAAGG + Intergenic
1059586145 9:115608823-115608845 AAAAAGTTTACTTTTTTTTAAGG - Intergenic
1059712798 9:116885014-116885036 ACAAATTTCCCCTTTTTATAAGG + Intronic
1059882761 9:118710024-118710046 AAAAAGTGTCCTTTGTTTAATGG - Intergenic
1060069092 9:120530986-120531008 AAAAATTATACTTTGTTTTAGGG - Intronic
1060097515 9:120805331-120805353 ACAAATTTTCCTTTCTCTTATGG - Intergenic
1061797317 9:133094337-133094359 ACAAATTTTATTTTATTTTGAGG - Intergenic
1061996071 9:134186715-134186737 ACAAATTATGCTTTGTTTGTTGG + Intergenic
1185925531 X:4141827-4141849 ACAAAATTTCATTCCTTTTATGG + Intergenic
1185951063 X:4434804-4434826 ACAAGATTTCCTTTTTTTCAAGG - Intergenic
1186087215 X:6003511-6003533 ACAAATTTTCGTTTGTTTTATGG - Intronic
1186087707 X:6009020-6009042 TCAGAATTTCCTTTCTTTTAAGG + Intronic
1186342959 X:8662675-8662697 ACAAATTTTTCCTTGTTATAAGG - Intronic
1186801982 X:13102390-13102412 ACCATTTTTCCTTTGGTTCATGG + Intergenic
1186912796 X:14187082-14187104 AAATAATTTCCTCTGTTTTATGG + Intergenic
1186966441 X:14791279-14791301 CCAAATTTTCCTCTTTTATAAGG - Intergenic
1187261559 X:17689283-17689305 AAAAATTTTCCTTGGTTATTAGG + Intronic
1187303744 X:18076578-18076600 ACACATTCTTCTTTGATTTAGGG - Intergenic
1187303920 X:18077872-18077894 ACACATTCTCCTTTGATTTACGG - Intergenic
1187322626 X:18254440-18254462 ACATATTTTACATTATTTTAGGG - Intronic
1187936946 X:24345436-24345458 AAAGATTTTCCTTTGTGTTGTGG - Intergenic
1188302874 X:28527076-28527098 ACCAATTCTCCTGGGTTTTAGGG - Intergenic
1188469694 X:30524178-30524200 ACAGGATTTCATTTGTTTTATGG + Intergenic
1188490019 X:30728014-30728036 ATAAATCTTCCCTGGTTTTAGGG - Intronic
1188857705 X:35218039-35218061 ACAAATCTGCCTGTGTTCTATGG + Intergenic
1188860449 X:35249557-35249579 ACAAGATTTCATTTTTTTTAAGG + Intergenic
1188876496 X:35436733-35436755 ATAATTTTTTCTTTATTTTAAGG + Intergenic
1188957677 X:36453228-36453250 AGAAAATTTCCTTAGTTTTGTGG + Intergenic
1189302761 X:39964485-39964507 CCAAATTTTCCCTTCTTATAAGG + Intergenic
1189760237 X:44314685-44314707 CCAACTTTTGCTTTGTTTTATGG - Intronic
1189801027 X:44692038-44692060 CCAAATTTTCCCTTTTTATAAGG + Intergenic
1189910677 X:45807546-45807568 ACAAGATTTCCTTATTTTTAAGG - Intergenic
1189966980 X:46385011-46385033 ACAAATATTGCTTTTATTTATGG - Intergenic
1189986785 X:46560523-46560545 ATAAGTTTTCATTTCTTTTAAGG + Intergenic
1190706087 X:53029508-53029530 ACAAATCCTCCTTTGTCTCAGGG - Intergenic
1190867644 X:54398187-54398209 ACAAAGTTCATTTTGTTTTAAGG - Intergenic
1191048735 X:56168072-56168094 ACCAATTTTCCATTGTTTATTGG - Intergenic
1191864058 X:65689778-65689800 ACAACTTTTCCTTTCTCTAAAGG - Intronic
1192423588 X:71055602-71055624 ACAATTTTTCCTTTATATGATGG - Intergenic
1192736875 X:73857829-73857851 ACAGATTTTCCTTCTTTTTAAGG + Intergenic
1193470846 X:81901152-81901174 CTTTATTTTCCTTTGTTTTATGG - Intergenic
1193631603 X:83895738-83895760 ACATTTTTTTCTTTGTTTTCTGG + Intergenic
1193747874 X:85304649-85304671 ACAAATTTCTCCTTTTTTTAAGG + Intronic
1193792544 X:85833162-85833184 ACAAAATTTCCTCTGTTTTAAGG - Intergenic
1193894213 X:87091822-87091844 ACAGAATTTCCTTTGATTTATGG + Intergenic
1193949090 X:87776050-87776072 ACAAATTTTTCTTTTTTATTTGG + Intergenic
1194320760 X:92442738-92442760 ACATAATTTCCTTTCTTTTATGG + Intronic
1194415879 X:93611303-93611325 ACATATTTTCCTATCTTTAATGG - Intergenic
1194514481 X:94834571-94834593 CCAAATTTTCTTTTTTTCTAAGG + Intergenic
1194527329 X:94993224-94993246 ACAGAATTTTCTTTGTTTTAAGG + Intergenic
1194539024 X:95147090-95147112 CCAAATTTTCTTTTGATTTTGGG + Intergenic
1194697325 X:97069711-97069733 ACAAATTTTACTGTGATTCATGG + Intronic
1194712067 X:97247529-97247551 ACACATTTTCATTTATTTCATGG + Intronic
1195447355 X:104969746-104969768 ACAACTTTTCCTGTGTTTATTGG - Intronic
1195503918 X:105635152-105635174 ACAAATTTTGCTTTGCTCCAGGG - Intronic
1195508914 X:105691510-105691532 ACTAATTTTGTTTTGGTTTATGG - Intronic
1195633233 X:107082789-107082811 ACAAATTTGTCTTTGTTATAAGG - Intronic
1195854259 X:109313371-109313393 ATAATTTTTCCTTTACTTTAAGG + Intergenic
1196356772 X:114804008-114804030 ACAAATGCTCCTTCGTTTTAAGG + Intronic
1196609392 X:117694649-117694671 ACAGAATTTCCTTATTTTTAAGG + Intergenic
1197274420 X:124461565-124461587 ATAAAATTTCCTTCTTTTTATGG - Intronic
1197636829 X:128924638-128924660 ACATATTTTCATGTGTTTAATGG - Intergenic
1197656200 X:129118718-129118740 ACAAATTTTTATTTGGTTTCTGG + Intergenic
1197701291 X:129602010-129602032 CCAAATTTCCCTTTTTTATAAGG - Intergenic
1197704751 X:129626563-129626585 ACACAATTTCATTTATTTTATGG - Intergenic
1198568175 X:137926807-137926829 ACAAATTTTCCTGGGATTGAGGG - Intergenic
1198624509 X:138554908-138554930 ACAAGTTTTTCTTTCTTTTTTGG - Intergenic
1199062068 X:143368752-143368774 ACAAATTTTTTTTTATTATAGGG - Intergenic
1199431927 X:147771596-147771618 AGCTATTTTCCTCTGTTTTATGG - Intergenic
1199550209 X:149052792-149052814 ACAGAATTTCCTTCTTTTTAAGG - Intergenic
1199815646 X:151394690-151394712 CCAAATTTTCCCTTTTTATAAGG - Intergenic
1200415212 Y:2902850-2902872 ACAAATTTTCCTTTGTTTTATGG + Intronic
1200628872 Y:5555874-5555896 ACATAATTTCCTTTCTTTTATGG + Intronic
1201264908 Y:12196711-12196733 ACAAATTTTCCTTTGTTTTATGG + Intergenic
1202171575 Y:22051131-22051153 AAAAATGTTCCTTCATTTTATGG - Intergenic
1202219787 Y:22535241-22535263 AAAAATGTTCCTTCATTTTATGG + Intergenic
1202237475 Y:22728581-22728603 ACAAATTTTCCTTTGTTTCATGG + Intergenic
1202299115 Y:23392329-23392351 AAAAATATTTCATTGTTTTAGGG + Intergenic
1202323390 Y:23660842-23660864 AAAAATGTTCCTTCATTTTATGG - Intergenic
1202547381 Y:26009212-26009234 AAAAATGTTCCTTCATTTTATGG + Intergenic
1202571694 Y:26278269-26278291 AAAAATATTTCATTGTTTTAGGG - Intergenic