ID: 1173679586

View in Genome Browser
Species Human (GRCh38)
Location 20:44868482-44868504
Sequence TCCCAGCTCTATATTCCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173679586_1173679593 25 Left 1173679586 20:44868482-44868504 CCATGGGGAATATAGAGCTGGGA No data
Right 1173679593 20:44868530-44868552 GTCCACCTCGAACAGTCATAGGG No data
1173679586_1173679590 -1 Left 1173679586 20:44868482-44868504 CCATGGGGAATATAGAGCTGGGA No data
Right 1173679590 20:44868504-44868526 ATGGCAAGAGGACAGGACCTTGG No data
1173679586_1173679589 -8 Left 1173679586 20:44868482-44868504 CCATGGGGAATATAGAGCTGGGA No data
Right 1173679589 20:44868497-44868519 AGCTGGGATGGCAAGAGGACAGG No data
1173679586_1173679592 24 Left 1173679586 20:44868482-44868504 CCATGGGGAATATAGAGCTGGGA No data
Right 1173679592 20:44868529-44868551 TGTCCACCTCGAACAGTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173679586 Original CRISPR TCCCAGCTCTATATTCCCCA TGG (reversed) Intergenic