ID: 1173679593

View in Genome Browser
Species Human (GRCh38)
Location 20:44868530-44868552
Sequence GTCCACCTCGAACAGTCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173679586_1173679593 25 Left 1173679586 20:44868482-44868504 CCATGGGGAATATAGAGCTGGGA No data
Right 1173679593 20:44868530-44868552 GTCCACCTCGAACAGTCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173679593 Original CRISPR GTCCACCTCGAACAGTCATA GGG Intergenic