ID: 1173681505

View in Genome Browser
Species Human (GRCh38)
Location 20:44885602-44885624
Sequence TTGCCACGGCCCCACGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 109}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173681505_1173681523 21 Left 1173681505 20:44885602-44885624 CCCCTCCCGTGGGGCCGTGGCAA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1173681523 20:44885646-44885668 TGAGAACACGGTTTGGGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 108
1173681505_1173681517 15 Left 1173681505 20:44885602-44885624 CCCCTCCCGTGGGGCCGTGGCAA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1173681517 20:44885640-44885662 GCCCAATGAGAACACGGTTTGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1173681505_1173681522 20 Left 1173681505 20:44885602-44885624 CCCCTCCCGTGGGGCCGTGGCAA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1173681522 20:44885645-44885667 ATGAGAACACGGTTTGGGGCGGG 0: 1
1: 0
2: 0
3: 16
4: 149
1173681505_1173681524 26 Left 1173681505 20:44885602-44885624 CCCCTCCCGTGGGGCCGTGGCAA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1173681524 20:44885651-44885673 ACACGGTTTGGGGCGGGGCGCGG 0: 1
1: 0
2: 1
3: 24
4: 353
1173681505_1173681519 16 Left 1173681505 20:44885602-44885624 CCCCTCCCGTGGGGCCGTGGCAA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1173681519 20:44885641-44885663 CCCAATGAGAACACGGTTTGGGG 0: 1
1: 0
2: 1
3: 8
4: 101
1173681505_1173681516 14 Left 1173681505 20:44885602-44885624 CCCCTCCCGTGGGGCCGTGGCAA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1173681516 20:44885639-44885661 TGCCCAATGAGAACACGGTTTGG 0: 1
1: 0
2: 0
3: 3
4: 53
1173681505_1173681515 9 Left 1173681505 20:44885602-44885624 CCCCTCCCGTGGGGCCGTGGCAA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1173681515 20:44885634-44885656 TCGCTTGCCCAATGAGAACACGG 0: 1
1: 0
2: 0
3: 6
4: 71
1173681505_1173681521 19 Left 1173681505 20:44885602-44885624 CCCCTCCCGTGGGGCCGTGGCAA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1173681521 20:44885644-44885666 AATGAGAACACGGTTTGGGGCGG 0: 1
1: 1
2: 2
3: 8
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173681505 Original CRISPR TTGCCACGGCCCCACGGGAG GGG (reversed) Intergenic
900264196 1:1749192-1749214 GTGCCAAGGCCCCATGGGTGGGG + Intergenic
900392751 1:2440876-2440898 TGGCCACGTCCCCCCGGGAACGG + Intronic
900612836 1:3551634-3551656 TTGCCACAGCCACAGGGGACAGG + Intronic
904093763 1:27962043-27962065 TTGCCCCGGCCACACAGGGGAGG - Intronic
904495294 1:30883149-30883171 TTGCCAAGGCCACACAGCAGGGG + Intronic
905229820 1:36508053-36508075 TTGCCAGTGCCCCAGCGGAGGGG + Intergenic
906140677 1:43531768-43531790 TGGCCACGTCCTCACGGGACAGG - Intronic
910485229 1:87705767-87705789 TTGCCAGGGACCCATGGGTGAGG - Intergenic
910768618 1:90808405-90808427 TGGCCACAGCCCCATTGGAGAGG + Intergenic
913565490 1:120069149-120069171 TTGGCGGGGCACCACGGGAGGGG + Intronic
913632643 1:120724413-120724435 TTGGCGGGGCACCACGGGAGGGG - Intergenic
914286088 1:146228524-146228546 TTGGCGGGGCACCACGGGAGGGG + Intronic
914547119 1:148679277-148679299 TTGGCGGGGCACCACGGGAGGGG + Intronic
914619388 1:149391085-149391107 TTGGCGGGGCACCACGGGAGGGG - Intergenic
915302942 1:154961884-154961906 TTACCACGGCACCACGCGAGTGG + Intronic
1063135833 10:3215366-3215388 TTGCCAGGGGCTGACGGGAGGGG - Intergenic
1063929722 10:11017659-11017681 TTGCCAGGGACCCCCGGGCGGGG + Intronic
1067033709 10:42898176-42898198 TCGCCCCGGCCCCGCGGTAGAGG - Intergenic
1068061380 10:52072028-52072050 TGGTGATGGCCCCACGGGAGAGG - Intronic
1070474609 10:76819169-76819191 TTGCCCCGGCCCCAGGAAAGCGG - Intergenic
1070474629 10:76819233-76819255 TTGCCCCGGCCCCAGGAAAGCGG - Intergenic
1070474668 10:76819361-76819383 TTGCCCCGGCCCCAGGAAAGCGG - Intergenic
1074121604 10:110497798-110497820 TGGCCACGGCCCGAGGGGCGGGG + Intergenic
1075345321 10:121677956-121677978 TGGCCACTGCCCCTGGGGAGGGG + Intergenic
1075672009 10:124269242-124269264 TGGACATGGCCCCAGGGGAGCGG - Intergenic
1076040879 10:127247459-127247481 TTGCCATGGCCCAAGAGGAGAGG + Intronic
1077334889 11:1998820-1998842 TTCCCATGGCCCCACCGGAAAGG + Intergenic
1077429306 11:2508118-2508140 TTGCCTTGGCCCCACGGCAGTGG + Intronic
1077442851 11:2576774-2576796 TTGGCACTGCCCAGCGGGAGGGG + Intronic
1079967205 11:26994233-26994255 TTGCCAGGGCCCCGGAGGAGGGG + Exonic
1085042002 11:73331977-73331999 CTACCATGGCCCCATGGGAGGGG + Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1202817872 11_KI270721v1_random:54002-54024 TTCCCATGGCCCCACCGGAAAGG + Intergenic
1096156747 12:49345426-49345448 AAGCCCCGGCCCCGCGGGAGCGG - Intergenic
1102098975 12:110262892-110262914 TTGCCAGGGAACCAAGGGAGGGG + Intergenic
1102246727 12:111361124-111361146 TTGTCACTGCCCCCGGGGAGAGG - Exonic
1102550158 12:113685736-113685758 CTGCCACGGCCTAACTGGAGGGG + Intergenic
1103915952 12:124375867-124375889 TTTCCACTGCCCCCGGGGAGGGG + Intronic
1106413140 13:29524814-29524836 TGGGCACTGGCCCACGGGAGGGG + Intronic
1108221160 13:48234002-48234024 TTTCCACGGCCCTTCGGTAGTGG + Intronic
1110119834 13:71866816-71866838 TTGCCACACACCCCCGGGAGGGG + Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1116486438 14:45454551-45454573 TTGCCAGGGCCCAAAAGGAGTGG - Intergenic
1118837156 14:69485305-69485327 TTGCCACCGCCCCAGGGCAGGGG - Intronic
1119728671 14:76937566-76937588 TTGCCACTGCCACAGGGGAGGGG + Intergenic
1121216322 14:92251184-92251206 TTGCCACTTCCCCACGCGAAAGG + Intergenic
1127184569 15:56464992-56465014 TGGCCGCGGTCCCACGAGAGGGG - Exonic
1127822927 15:62676006-62676028 TCTCCACGGCCCCAGGCGAGAGG - Intronic
1128128398 15:65209763-65209785 TTGCCACGTTCCCACGGGCTTGG - Exonic
1128373743 15:67060567-67060589 TTGCCAAGGGCCAAAGGGAGAGG - Intergenic
1129552142 15:76464172-76464194 TTGCCAGGGACCAAGGGGAGGGG - Intronic
1131397223 15:92096193-92096215 CTGCCATGGGCCCACAGGAGGGG + Intronic
1132691351 16:1183176-1183198 TTCCCACAGCCGCACGGGGGTGG - Intronic
1132985996 16:2767950-2767972 TTGCCACTGCCCCAGAGGAAAGG - Exonic
1133087526 16:3376394-3376416 TGGTCACTGCCCCAAGGGAGAGG - Intronic
1135770577 16:25215124-25215146 TTTCCACGGCCCGAGGGGAAGGG - Intergenic
1137843659 16:51665580-51665602 TTCCCCCGGCCTCACTGGAGCGG + Intergenic
1139454336 16:67060457-67060479 TTGCCAGGGGCACAGGGGAGTGG - Intronic
1142425598 16:90000717-90000739 TTGCCAAGGCCCCAGGTAAGTGG - Intergenic
1142486045 17:248245-248267 TTGTCACTGCCCCTCGGGAGAGG + Intronic
1142757266 17:2023856-2023878 CTGCCCCGGCCCTGCGGGAGCGG - Intronic
1143785344 17:9251520-9251542 CTGCCAAGGCCCCACGAGAGAGG + Intronic
1147244623 17:39111785-39111807 ATGCCACGGCCCCTGGGGTGAGG + Intronic
1147258886 17:39197379-39197401 GTGGCCCGGCCCAACGGGAGGGG - Intronic
1147338224 17:39739484-39739506 ACGCCCCGCCCCCACGGGAGAGG - Intronic
1148189943 17:45671529-45671551 TTGCCACTGCCCCACAGCAGGGG - Intergenic
1149891470 17:60393128-60393150 TTGCCACGGACCAGTGGGAGGGG - Intronic
1151418546 17:73982601-73982623 TTTCCACTCCCCCACCGGAGAGG - Intergenic
1152212080 17:79008111-79008133 TTGCCACGTCCAGAGGGGAGAGG + Intronic
1152770301 17:82163443-82163465 GTGCCATGGCCTCACGGGAAAGG - Intronic
1155461742 18:26090976-26090998 TTGCCACGGCGCGAAGGGGGCGG - Intronic
1158102648 18:53847573-53847595 TTGCCAGGGGCTTACGGGAGGGG + Intergenic
1160264759 18:77332031-77332053 TTGCCAAGGGCTCAAGGGAGAGG - Intergenic
1162906280 19:13825933-13825955 ATGCCACGCCCCCAAGGAAGTGG - Intronic
928493843 2:31811830-31811852 ATGCCACAGCCCCACAGGAGAGG - Intergenic
929992856 2:46804125-46804147 TTGCCACAGCCCCACGAGGCAGG - Intergenic
935396803 2:102618917-102618939 TTCCCACGCCCCCACGGAATCGG - Intergenic
938063859 2:128270713-128270735 TGGTCACGGCCCCACAGGAGTGG - Intronic
948330476 2:237160619-237160641 TTGCCAAGGCCGCACAGAAGTGG - Intergenic
1172699674 20:36845522-36845544 CTGGCACGGCCCCACGTGAGAGG + Intronic
1173681505 20:44885602-44885624 TTGCCACGGCCCCACGGGAGGGG - Intergenic
1174407720 20:50312946-50312968 TGGCAAGGCCCCCACGGGAGTGG + Intergenic
1175760671 20:61560624-61560646 TCGCCAGGGCCCCGCGGGTGGGG - Intronic
1183954485 22:41371206-41371228 TGGCCAGGGCCCCATGGGAGAGG - Intronic
1184841207 22:47053323-47053345 TTGCCAGGGCCCCTCCTGAGAGG + Intronic
950721577 3:14886554-14886576 TTGCCACAGCCTCATCGGAGGGG - Intronic
964498511 3:157322117-157322139 TTGCCAGGGGCTCAGGGGAGAGG - Intronic
966498013 3:180602437-180602459 GTGCCACTGCGCCACGGAAGAGG + Intronic
966806357 3:183810843-183810865 TTGTAAAGGCCCCACGAGAGCGG + Exonic
968753666 4:2403311-2403333 TTCCCACGCCCCCACTTGAGTGG - Intronic
975582682 4:75921016-75921038 GTGGCACGTCCCCCCGGGAGGGG - Exonic
976398638 4:84583428-84583450 CTGCCCCGGCCCCAGGGAAGCGG + Exonic
981580551 4:146244934-146244956 GTGTCACGGCCCCAGGGAAGGGG + Intergenic
985575791 5:672967-672989 TTGCCATGGCTCCACCGGCGTGG - Intronic
987301377 5:16600588-16600610 CTGCCCCGCCCCCACAGGAGAGG + Intronic
988632383 5:32944896-32944918 TTGCCTGGGCACCACAGGAGAGG - Intergenic
1001320744 5:170679026-170679048 TTGCTAGGGCCCCAGAGGAGAGG + Intronic
1001444844 5:171775201-171775223 TGGCCAAGGGCCCACGGGATGGG - Intergenic
1002082248 5:176744023-176744045 CTGCCCCGGCCCCCCGGGACGGG - Intergenic
1003424980 6:5992984-5993006 TTGCCACTGCTCCTGGGGAGGGG + Intergenic
1004203260 6:13569713-13569735 TTGATACGGCCCCATGGGAAAGG + Intergenic
1006804593 6:36779821-36779843 TTGCAGAGGCCACACGGGAGGGG - Intronic
1007118521 6:39361641-39361663 TGGCGAGGGCCCCAAGGGAGTGG + Intronic
1007739514 6:44002280-44002302 CTGCCACGGCCCCGCGGGGGAGG - Intronic
1019791386 7:3016133-3016155 TGGACACAGCCCCACGGGAAGGG - Intronic
1024748504 7:52434571-52434593 TTGCTAAGTTCCCACGGGAGAGG + Intergenic
1025087359 7:56034205-56034227 TTGGCCCCGCCCCAGGGGAGGGG + Intronic
1026819164 7:73535172-73535194 CTGCCAGGGCCCGAGGGGAGGGG + Intergenic
1031144181 7:117979404-117979426 TTACCAAAGCCCCATGGGAGAGG - Intergenic
1032110685 7:129072719-129072741 TTGCCAGGGGCCGAGGGGAGGGG + Intergenic
1032695176 7:134329723-134329745 TTGCCACAGCCCTATGGGAGAGG + Intergenic
1036605173 8:10298452-10298474 TTGCCAGGGCCCAGTGGGAGCGG + Intronic
1040461850 8:47656990-47657012 TTGCCAGGGACTCAGGGGAGGGG + Intronic
1044173807 8:89091260-89091282 TTGCCAGGGGCTCAGGGGAGAGG + Intergenic
1049709167 8:144055999-144056021 ATGCCACGGCCCCAGGCCAGGGG + Intronic
1056819100 9:89824360-89824382 TAGCCACTGCCCCAGGTGAGAGG - Intergenic
1057893806 9:98890228-98890250 TTGCCAAGGGCACAGGGGAGAGG - Intergenic
1058973194 9:110101671-110101693 TTCCCACGGCCTCTCTGGAGGGG + Intronic
1060818212 9:126646595-126646617 TGGCTCTGGCCCCACGGGAGAGG - Intronic
1061802298 9:133119310-133119332 TTACCAAGGGCCCAAGGGAGGGG - Intronic
1062234053 9:135499783-135499805 AGGCCACGGCCCCGCCGGAGAGG - Exonic
1194331719 X:92591230-92591252 TCGCCAGGGCCCCAAGGGAAAGG + Intronic
1200640424 Y:5710289-5710311 TCGCCAGGGCCCCAAGGGAAAGG + Intronic