ID: 1173687414

View in Genome Browser
Species Human (GRCh38)
Location 20:44933198-44933220
Sequence AGGGCCAAGGGGAATGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 758
Summary {0: 1, 1: 0, 2: 5, 3: 79, 4: 673}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173687400_1173687414 8 Left 1173687400 20:44933167-44933189 CCTCATACCCAGAGAGTAGGTGA 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1173687414 20:44933198-44933220 AGGGCCAAGGGGAATGGGGGTGG 0: 1
1: 0
2: 5
3: 79
4: 673
1173687397_1173687414 27 Left 1173687397 20:44933148-44933170 CCAGGTGCCACGCACGGTGCCTC 0: 1
1: 0
2: 3
3: 46
4: 518
Right 1173687414 20:44933198-44933220 AGGGCCAAGGGGAATGGGGGTGG 0: 1
1: 0
2: 5
3: 79
4: 673
1173687402_1173687414 1 Left 1173687402 20:44933174-44933196 CCCAGAGAGTAGGTGAGTGTGGG 0: 1
1: 0
2: 1
3: 15
4: 228
Right 1173687414 20:44933198-44933220 AGGGCCAAGGGGAATGGGGGTGG 0: 1
1: 0
2: 5
3: 79
4: 673
1173687396_1173687414 28 Left 1173687396 20:44933147-44933169 CCCAGGTGCCACGCACGGTGCCT 0: 1
1: 0
2: 1
3: 24
4: 306
Right 1173687414 20:44933198-44933220 AGGGCCAAGGGGAATGGGGGTGG 0: 1
1: 0
2: 5
3: 79
4: 673
1173687398_1173687414 20 Left 1173687398 20:44933155-44933177 CCACGCACGGTGCCTCATACCCA 0: 1
1: 0
2: 6
3: 152
4: 3003
Right 1173687414 20:44933198-44933220 AGGGCCAAGGGGAATGGGGGTGG 0: 1
1: 0
2: 5
3: 79
4: 673
1173687404_1173687414 0 Left 1173687404 20:44933175-44933197 CCAGAGAGTAGGTGAGTGTGGGT 0: 1
1: 0
2: 0
3: 16
4: 236
Right 1173687414 20:44933198-44933220 AGGGCCAAGGGGAATGGGGGTGG 0: 1
1: 0
2: 5
3: 79
4: 673

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173687414 Original CRISPR AGGGCCAAGGGGAATGGGGG TGG Intronic
900146536 1:1161163-1161185 AGGGCCACGGAGAATCGTGGAGG - Intergenic
900149210 1:1170934-1170956 AGGGCCAGGCAGAATGGGGGAGG - Intergenic
900164854 1:1240581-1240603 GGGGCCAGGGTGAATGGGGGGGG - Intergenic
900164904 1:1240685-1240707 AGGGCCCGGGTGAATGGGGGCGG - Intergenic
900181311 1:1312184-1312206 AGGGCCCAAGGGAGTGGGGGGGG + Intronic
900233404 1:1574400-1574422 CGGGCCAGGGGGAACCGGGGAGG + Intronic
900490435 1:2946225-2946247 AGGGCTACGGGGACTGGGGCTGG - Intergenic
900581834 1:3413277-3413299 AGCGGCAGGGGGAATGGGGAGGG + Intronic
901144923 1:7058226-7058248 AGCCCCAGGGGGAATGGGGGTGG - Intronic
901454739 1:9356618-9356640 AGGACCATGGGGACTGAGGGAGG - Intronic
901810351 1:11763872-11763894 AGGGAGAAGGGGAATCGGGGTGG + Intronic
901861187 1:12075618-12075640 ATGGCAAAGGGGAATCAGGGTGG - Intronic
901956158 1:12787365-12787387 AGAGCCAACGGGGATGGGTGAGG - Intergenic
901961266 1:12828397-12828419 AGGCCCAAGGGGGATGGTGGTGG - Intronic
901967859 1:12883002-12883024 AGGCCCAAGGGGGATGGTGGTGG - Intronic
901975663 1:12942132-12942154 AGGCCCAAGGGGGATGGTGGTGG - Intronic
901979538 1:13023434-13023456 AGAGCCAATGGGGATGGGTGAGG - Intronic
901983257 1:13053267-13053289 AGGCCCAAGGGGGATGGTGGTGG - Intronic
901987911 1:13090914-13090936 AGAGCCAATGGGGATGGGTGAGG - Intergenic
901993901 1:13135853-13135875 AGAGCCAATGGGGATGGGTGAGG + Intergenic
901998832 1:13175651-13175673 AGGCCCAAGGGGGATGGTGGTGG + Intergenic
902002545 1:13205504-13205526 AGAGCCAATGGGGATGGGTGAGG + Intergenic
902009511 1:13259633-13259655 AGGCCCAAGGGGGATGGTGGTGG + Intronic
902017317 1:13318778-13318800 AGGCCCAAGGGGGATGGTGGTGG + Intronic
902021779 1:13351268-13351290 AGAGCCAATGGGGATGGGTGAGG + Intergenic
902163394 1:14550750-14550772 AGGGGGAAGGGGAGAGGGGGTGG - Intergenic
902402476 1:16165827-16165849 AAGGGGAATGGGAATGGGGGAGG - Intergenic
902490348 1:16776562-16776584 AGGGCCAAGGCACATGGGGGTGG + Intronic
902552495 1:17227644-17227666 AGGGTGAAGGGGAATCGGGAAGG - Intronic
902662671 1:17916018-17916040 AGGGCACAGAAGAATGGGGGAGG + Intergenic
902943463 1:19816608-19816630 AGGGCCCAGGGGGAGTGGGGAGG - Intergenic
903018905 1:20379908-20379930 GGGGCCAAGGGGCTGGGGGGTGG - Intergenic
903172427 1:21562675-21562697 AGGGGGAAGGGGACTGGGGAAGG - Intronic
903623526 1:24715107-24715129 AGGCCCCAGGGGGATGGGGTGGG + Intergenic
903858403 1:26350882-26350904 AGGACAATGGGAAATGGGGGAGG - Intronic
903907446 1:26696629-26696651 GGGGCCGAGAGCAATGGGGGTGG + Exonic
904035670 1:27557269-27557291 AGGGCCAAGGGCAGGAGGGGAGG - Intronic
904042687 1:27593515-27593537 AGGGCCAGAGGGAATGGGCCAGG - Intronic
904255285 1:29250803-29250825 AGGGACCAGGGGAAGGGGTGAGG + Intronic
904596122 1:31646725-31646747 GGAGCTAAGGGGAATGTGGGAGG - Intergenic
904608703 1:31713566-31713588 ATGGGGAAGGGGAATGGGAGTGG + Intergenic
904751207 1:32742168-32742190 AGGGCCAAGGGCAAAGGCCGAGG + Exonic
904829876 1:33299729-33299751 CGGGCCCAGGGAAATGGGGTGGG + Exonic
904842093 1:33379354-33379376 GGGGACAGGGGGGATGGGGGGGG - Intronic
904893708 1:33798553-33798575 AGGGCCAAGGAGAGTGGGACAGG + Intronic
905036728 1:34923525-34923547 AGGGGCCAGGGAAAAGGGGGTGG + Intronic
905047922 1:35023000-35023022 AGGGCCAACGGGGAGGGAGGGGG + Intronic
905266344 1:36756580-36756602 AGGGCAAGGGGGAGTGGGTGGGG + Intergenic
905337591 1:37256161-37256183 AGTGCCAAGGAGAAAGGAGGCGG - Intergenic
905451441 1:38059394-38059416 AGGGCCTGGAGGAATGGGGGTGG + Intergenic
905653284 1:39670871-39670893 AGAGCCTAGGGGAGTTGGGGGGG - Intronic
905862296 1:41359833-41359855 AGGGCCAAGGGTGAGGGTGGGGG - Intergenic
906741203 1:48187160-48187182 AGGGCCAAGGGAGACAGGGGTGG + Intergenic
907237312 1:53061613-53061635 AGGGCCAACAGGGATGGGAGTGG + Intergenic
907299342 1:53476802-53476824 AGGGTCAAGGGGCCTGGGCGAGG + Intergenic
907303484 1:53502009-53502031 AGGGACAAGGGGCCTGGGGTGGG + Intergenic
907391265 1:54160036-54160058 AGGGCCCTGGGGACTTGGGGGGG + Intronic
907410730 1:54281614-54281636 AGGTCCACGGGGAATGTGGACGG - Intronic
907559997 1:55379543-55379565 AGGGCAAAGGGGGATTGGGAGGG - Intergenic
908089445 1:60670774-60670796 AGGGCCAAGTGGAGTGGGTTAGG + Intergenic
908544393 1:65148891-65148913 AGGGCTAAGGGGTACGGGGACGG - Intronic
910336604 1:86139165-86139187 AGGGAGAAGGAGAAAGGGGGGGG + Intronic
910856155 1:91697948-91697970 AGGGGAAAGGGGAAGGGGGAAGG + Intronic
911115319 1:94240027-94240049 AAGGCCAAGGAGAGTGGGGTTGG + Intronic
911116055 1:94247646-94247668 CGGGCCGTGGGGGATGGGGGCGG - Intronic
912170316 1:107091926-107091948 AGGGCCAATGGGAATTTAGGTGG + Intergenic
913203731 1:116517040-116517062 AGGGCCACGGGGAAAGGGGATGG - Intronic
913248113 1:116888125-116888147 AGGGATAAGGGGAAGGGGAGGGG + Intergenic
913287649 1:117241424-117241446 GGGGGGAAGGGGAGTGGGGGTGG - Intergenic
914474238 1:148010092-148010114 AGGGGCAGGGGGGATGGGGGTGG + Intergenic
915239220 1:154507898-154507920 GGGGCCCAGGGGAATGCAGGAGG - Intronic
915446295 1:155976709-155976731 AGAGCCAAGGGGGGCGGGGGAGG - Intronic
915574730 1:156768009-156768031 AGGCCGAAGGGCAAGGGGGGAGG - Exonic
915606161 1:156952530-156952552 AAGGACAAGGGGAAATGGGGAGG + Intronic
916059951 1:161091519-161091541 AGGGCCAGCGGGAATGGGAGGGG + Intergenic
918750908 1:188268312-188268334 ATGGACCAGGGGGATGGGGGTGG + Intergenic
918913734 1:190607936-190607958 TGATCCAAGGGGAATGGGGGTGG + Intergenic
919738847 1:200970620-200970642 AGGCCCAAGGGCAGTGGGGATGG + Intronic
920054476 1:203182281-203182303 GGGGCCAACAGGAAAGGGGGAGG + Intronic
920230190 1:204465165-204465187 AGGGCTATGGGGGATGGGGAGGG - Intronic
920367465 1:205455658-205455680 AGGAACAAAGGCAATGGGGGCGG + Intronic
920583701 1:207137203-207137225 AGAGCTAAGGGGATTAGGGGTGG + Intronic
920842841 1:209569196-209569218 AGGGCCAAGGGGAAGTGTAGGGG - Intergenic
920949840 1:210562388-210562410 AGGGCCAAGGGGTGGGGGGTGGG + Intronic
921544753 1:216461450-216461472 AGGGATTTGGGGAATGGGGGTGG - Intergenic
922031976 1:221810022-221810044 ATTCCCAAGGGGAAAGGGGGTGG + Intergenic
922705794 1:227789402-227789424 AGGGCAAAGGGCAACTGGGGCGG - Intergenic
922791672 1:228314452-228314474 AGGGCCAGAGGGCATGGGGTAGG + Intronic
923133805 1:231099891-231099913 AGTCCCAAGGTGAATGGGGTTGG - Intergenic
923482474 1:234397506-234397528 AGGGGGAAGGGGGATGGGGAAGG + Intronic
923530092 1:234805968-234805990 AGGGCCAAGGCACATGGGGGTGG - Intergenic
924262902 1:242250392-242250414 AAGGTGAAGGGGAATGGGGAAGG + Intronic
924815828 1:247441195-247441217 AGGGGAAAGGGAAAGGGGGGGGG - Intronic
1062833815 10:623519-623541 AAGGCCAAGGGGAAGAGGGGAGG + Intronic
1062833863 10:623642-623664 AGGGGCGAGGGGAAGAGGGGAGG + Intronic
1062833901 10:623745-623767 AGGGCCAAGGGGAAGAGGGGAGG + Intronic
1063932430 10:11042691-11042713 GGGGCTAAGGGAAATTGGGGTGG - Intronic
1063958909 10:11290256-11290278 AGGGGAAAGGGGACTGGAGGAGG + Intronic
1066453352 10:35550873-35550895 AGGGGCAAGGGACCTGGGGGAGG - Intronic
1066721884 10:38348062-38348084 AAGGTGAAGGGGAATGGGGAAGG - Intergenic
1067048741 10:43000193-43000215 GGGGCCAGGGGCAGTGGGGGTGG + Intergenic
1067179211 10:43972228-43972250 AGGGCCCAGGGGAGTGGGGACGG + Intergenic
1067349773 10:45465368-45465390 AGGGCCAAGGGCCATGCAGGTGG - Intronic
1067364000 10:45608117-45608139 AGGGAAAAGGGGGAAGGGGGAGG + Intergenic
1067473369 10:46551350-46551372 TAGGCCAAGGAGGATGGGGGTGG - Intronic
1067858322 10:49817440-49817462 AGGCCCCAGTGGAATGGGGATGG + Intergenic
1068411948 10:56667610-56667632 AGGGGGAAGGGGAAAGGGAGGGG - Intergenic
1068460720 10:57324734-57324756 AGGGGCTGGGGGACTGGGGGAGG + Intergenic
1068777863 10:60887615-60887637 AGGGCCAAGGAGCATGAGGACGG + Intronic
1069274019 10:66567022-66567044 AGGGACAAAGGGAAGGGGAGGGG + Intronic
1069599578 10:69694819-69694841 GGGGCCAAGGGGAATCTGGTAGG - Intergenic
1069664274 10:70144654-70144676 AGGAGCAAGGGGCATGTGGGGGG + Intronic
1069734979 10:70648102-70648124 ATGGCCAAGAGAAATGGAGGAGG + Intergenic
1069851580 10:71408800-71408822 AGGGCAGAGGGGAATGGGAAAGG + Intronic
1070025231 10:72625942-72625964 AAGGCGAAGGGGAAGGGGGTTGG - Intronic
1070290211 10:75108975-75108997 CTGGCCAAGGGGCATGGGGGTGG - Intronic
1071396672 10:85230629-85230651 AGGGCCAGGGGGAATTAGGGAGG + Intergenic
1072405321 10:95146987-95147009 AGGGACAAAGGGAAAGAGGGTGG - Intergenic
1072638957 10:97196491-97196513 CGGACAAACGGGAATGGGGGCGG + Intronic
1072948692 10:99834001-99834023 AGGACCAAGGGGAAGGGAGCTGG - Intronic
1073143641 10:101264972-101264994 AGAGCCAAGGGGAAGTGGGGAGG + Intergenic
1073249109 10:102111044-102111066 ATGGCCAAGGGAAAAGGGGCTGG - Intronic
1073577580 10:104639328-104639350 AGAGCCAAGAGGGATGGAGGAGG - Intergenic
1073772707 10:106752762-106752784 AATGCTAAGGAGAATGGGGGAGG + Intronic
1074863929 10:117534391-117534413 AGGGCCGAGGGGTCTGGAGGTGG - Intergenic
1074924432 10:118053150-118053172 AGGGGAAAGGGGAAAAGGGGAGG - Intergenic
1075291606 10:121236033-121236055 TGGGCCAAGGGGAAAGTGTGAGG - Intergenic
1076149888 10:128153369-128153391 GGTGCCAAGGGGAGTGGGGGAGG + Intergenic
1077082055 11:728608-728630 AGGTCCAAGAGGAAAAGGGGAGG + Intergenic
1077249472 11:1554622-1554644 AGGGACAAGGGGAAGGGGGAAGG + Exonic
1077272971 11:1690439-1690461 AGGGCCGTGGGGAATGGGACAGG + Intergenic
1077632092 11:3817639-3817661 AGGGACAAGGGGATGGGGGAAGG + Intronic
1077669866 11:4147286-4147308 AGGGCCAAAGCTAATGGGTGAGG - Intergenic
1077779263 11:5307649-5307671 AGGGGGAAGGGGGAAGGGGGAGG - Intronic
1077973750 11:7224150-7224172 CAGACCAAGTGGAATGGGGGCGG - Intergenic
1078059624 11:8034743-8034765 AGGGGAGAGGGGAATGGAGGGGG - Intronic
1078094697 11:8289642-8289664 AGGGCCCAGGGGAGGGGGGCTGG + Intergenic
1078175539 11:8967055-8967077 AGGGAAAAGGGGAATGGGAGAGG + Intergenic
1078718834 11:13864810-13864832 ATGGACATGGGGGATGGGGGTGG - Intergenic
1079111197 11:17606145-17606167 AGGGCCGAGGGCAATGGCAGGGG - Intronic
1079918954 11:26407818-26407840 AAGGCAAAGGGGAGTGGGGTAGG - Intronic
1080258779 11:30323201-30323223 AGGTGGAAGGGGAACGGGGGAGG + Exonic
1081112736 11:39157003-39157025 TGGGGGAAGGGGAAGGGGGGAGG - Intergenic
1081189727 11:40088638-40088660 ATGGCCAAGGGGCATTGTGGTGG + Intergenic
1081741583 11:45444781-45444803 TGGGCCAAGCGGGATGGGGGAGG - Intergenic
1081875203 11:46403833-46403855 AGGGCCAAGGGGAGTGGGGAGGG + Intronic
1081992497 11:47345374-47345396 AGGGATAAGGGGCCTGGGGGAGG + Intronic
1082244439 11:49905202-49905224 AGGGGGAAGGGGAAGGAGGGGGG + Intergenic
1082244480 11:49905298-49905320 AGGGGGAAGGGGGAAGGGGGAGG + Intergenic
1083589185 11:63882971-63882993 AGGGCTCTGGGGGATGGGGGTGG - Intronic
1083648165 11:64185266-64185288 AGGGCCGAGGGGAATTCGTGCGG - Exonic
1083722316 11:64609424-64609446 AGGGCCCATGGGAATGAGAGGGG + Intronic
1083967430 11:66051374-66051396 AAGGCCAAGGGGAGTTGGGGTGG + Intronic
1084116981 11:67048285-67048307 AGGATCAGGGGGAATTGGGGAGG + Intronic
1084171587 11:67403785-67403807 GGGGCCATGGGGAAGGTGGGAGG + Intronic
1084313744 11:68331827-68331849 GGGGCCAACAGGAATGGGGGTGG + Intronic
1084393043 11:68891065-68891087 AGGGCCCAGGGGAGTGGGGCGGG - Intergenic
1084703257 11:70801374-70801396 AGGGTGCAGGGGAATGGAGGAGG + Intronic
1084735686 11:71103845-71103867 AGGGAGAAGGGGAGGGGGGGAGG - Intronic
1085332641 11:75667009-75667031 AGGGCCAAGGGAACTGGGCTAGG + Intronic
1085526446 11:77166876-77166898 AGGGGCAAGGAGAATGTGGTGGG - Intronic
1085758570 11:79222171-79222193 AGGGTCAAGGGGAACAGGTGGGG + Intronic
1085879402 11:80448208-80448230 AGGGAGAAGGGGAATGGGAAAGG - Intergenic
1086338906 11:85827235-85827257 AGGGCCTTGGGGAATAGAGGTGG - Intergenic
1088898783 11:114098834-114098856 AGGGGAAAAGGAAATGGGGGAGG + Intronic
1089074173 11:115724774-115724796 ATGGCCAAGGGGAAGATGGGAGG - Intergenic
1089133027 11:116226959-116226981 AGGGCCAGTGGGAAAGGAGGAGG + Intergenic
1089201865 11:116729520-116729542 AGGTCCATGGTGACTGGGGGTGG + Intergenic
1090475788 11:127018800-127018822 AGGGCCCAGGGTAATGGAGTAGG + Intergenic
1090925127 11:131242909-131242931 AGGGTCAAAGGGATTAGGGGTGG - Intergenic
1091124435 11:133082593-133082615 AGGGGAAAGGGGGATGGGCGAGG - Intronic
1091223706 11:133945692-133945714 AGAGCCAAGAGGAAAGGGGTGGG + Intronic
1091239728 11:134044325-134044347 AAGGGCAGGGGGAATTGGGGTGG - Intergenic
1091753672 12:3038257-3038279 GGTGCCAAGGGGAGTGTGGGAGG - Intronic
1092114308 12:5988113-5988135 TGGGCAAAGGGGAAAGGAGGAGG + Intronic
1092701312 12:11234059-11234081 AGGGACAAGGAGAATGGAAGAGG + Intergenic
1093458089 12:19384145-19384167 AGGCCCAAAGGGAAGAGGGGAGG + Intergenic
1093465165 12:19440594-19440616 AGCGCCGAGGGGAAAGAGGGCGG - Intronic
1094523699 12:31218390-31218412 AAGGACAAGGGGAAAGGGGAAGG + Intergenic
1094772749 12:33684479-33684501 AGGGAGAAGGGGAAGGGGGAGGG - Intergenic
1095782846 12:46079139-46079161 AGGGCCAAGAGAGAAGGGGGAGG + Intergenic
1095798021 12:46241724-46241746 AGGGCCAAGGGGTAAGAGTGGGG - Intronic
1096110654 12:49027198-49027220 GGTGCCAAGGGGGAAGGGGGCGG + Exonic
1096229875 12:49890869-49890891 AGGGAGAAGGGGAATGGAGAAGG - Intronic
1096385421 12:51192003-51192025 AGGCCTAGGGAGAATGGGGGAGG - Intronic
1096489351 12:52005280-52005302 GGGGCCTAGAGGACTGGGGGTGG + Intergenic
1096499348 12:52055679-52055701 AGGGCCAAGGGGCTGGGGGGTGG - Intronic
1096600164 12:52723455-52723477 AGGGCCCTGGGGGATGGGGTAGG - Intergenic
1096829159 12:54301052-54301074 AGAGCCACGGGGAAAGGGGAGGG - Intronic
1096981128 12:55728720-55728742 AGAGCCCAGGGGAAAGGGGCTGG - Intronic
1096995153 12:55833655-55833677 ATGTCCAAGGTGAATGGGGCAGG + Intergenic
1097247017 12:57612235-57612257 AGGCCTAAGGGGATTGTGGGTGG - Intronic
1099511491 12:83544523-83544545 AGGGGCTGGGGGATTGGGGGAGG - Intergenic
1099738084 12:86596618-86596640 AGGACAAAAGGGAATGGAGGTGG - Intronic
1100214747 12:92435809-92435831 AGGGCCAAGGGCACTGAGGGAGG - Intergenic
1100375374 12:94010584-94010606 AGGGAGAGGGGGAATGGGAGTGG + Intergenic
1101135469 12:101739178-101739200 AGGGCCTAGTGGAAAGCGGGCGG - Intronic
1101557895 12:105827766-105827788 AGGGACTGGGGGACTGGGGGAGG + Intergenic
1102001559 12:109560974-109560996 AGGAACAAGGGGGAGGGGGGAGG - Intronic
1102310844 12:111842923-111842945 GGGGCCAAGGGTTATGGGTGTGG + Intronic
1102394181 12:112573992-112574014 AGGGAGAGGGGTAATGGGGGAGG + Intronic
1102575615 12:113854453-113854475 TGGGGGAAGGAGAATGGGGGTGG - Intronic
1102679941 12:114684562-114684584 AGGGCCAAGGAGGAAGGGGGAGG + Intergenic
1102749163 12:115277210-115277232 AGGGGAAAGGGGAGGGGGGGAGG + Intergenic
1102819092 12:115892912-115892934 AGGGGCTGGGGGAGTGGGGGTGG - Intergenic
1103037124 12:117665541-117665563 CGGGCCATGGGGAAGTGGGGAGG + Intronic
1103592587 12:122002857-122002879 AGGGAAAAGGGGAATGGGTGAGG - Intronic
1103626551 12:122224863-122224885 AAGGCCAAGGGCAAGGCGGGAGG + Intronic
1103782518 12:123408679-123408701 AGGATGAGGGGGAATGGGGGTGG - Exonic
1103824158 12:123722856-123722878 AGGGCCAGGGTAAATGTGGGAGG - Intronic
1103921679 12:124402579-124402601 AGGGCAGAGGGGAGTGGGGAGGG + Intronic
1104017864 12:124972452-124972474 AAGGCCAGTGGGCATGGGGGCGG - Intronic
1104052898 12:125208447-125208469 AGGGCCTGGAGGAATGGGGGTGG - Intronic
1104343458 12:127973619-127973641 TGGGCCAAGGGGCAGGGGTGAGG + Intergenic
1104959612 12:132482328-132482350 AGGGCCAATGGGACTGGCTGGGG - Intergenic
1104983019 12:132582421-132582443 AGGGTGAGAGGGAATGGGGGAGG - Intronic
1105062116 12:133162314-133162336 AGGGCCCAAGGGAGTGGGAGTGG - Intronic
1105217795 13:18299701-18299723 AGGATGAGGGGGAATGGGGGTGG - Intergenic
1105255215 13:18739741-18739763 AGGGCCAAGGGGAACCAGGGGGG - Intergenic
1105302534 13:19149307-19149329 AGGGCCAAGGGTGCTGTGGGGGG + Intergenic
1105951967 13:25236999-25237021 AGGACCTAGGGGAATCGTGGAGG - Intergenic
1106198126 13:27511315-27511337 AGGGCTGAGGGGAAAGGGAGTGG - Intergenic
1106582672 13:31031557-31031579 AGGCCAAAGGGGAAGGGGTGGGG - Intergenic
1108165660 13:47690385-47690407 AGGGGCAAGGGGGCTGGGAGAGG - Intergenic
1108271222 13:48761388-48761410 AGCACCAAAGGGAATGGGGCAGG - Intergenic
1108597065 13:51958606-51958628 AGGGCCAAGGGCCCTGGGGATGG + Intronic
1108616393 13:52137768-52137790 AGCGCCCAGAGGAATGTGGGAGG - Intronic
1108688883 13:52845640-52845662 AGGGAATAGGGGAATGGGAGTGG + Intronic
1108750094 13:53439819-53439841 AGGGGGGAGGGGGATGGGGGAGG - Intergenic
1108800915 13:54093167-54093189 AGGCCCAAGGGGAAGGTGGTCGG + Intergenic
1108804031 13:54132210-54132232 AGGGACACGGAGAAGGGGGGTGG + Intergenic
1108879902 13:55099757-55099779 AGGGATAAGGGAAAAGGGGGAGG - Intergenic
1110427232 13:75382135-75382157 AGAGCCAAGGGGAAGGAGAGAGG - Intronic
1110704525 13:78589378-78589400 AGGGTCAAGGGGAGAGCGGGCGG - Intergenic
1111349640 13:87010221-87010243 GGGGCCAACGGCAATGGGGCCGG - Intergenic
1112658696 13:101481928-101481950 AGAGTCAAGGGGAATGTGGTGGG + Intronic
1114311102 14:21468043-21468065 AGGGATGAGGGGGATGGGGGAGG + Intronic
1114549759 14:23525947-23525969 AGGTCCAAGGGAGGTGGGGGAGG + Exonic
1114616158 14:24069466-24069488 GGGGCCCTGGGGACTGGGGGTGG - Exonic
1114664639 14:24370296-24370318 CGGGCCAGAGGCAATGGGGGTGG - Exonic
1115656924 14:35452191-35452213 AGGGTCATGGGGGATTGGGGGGG - Intergenic
1115911017 14:38256139-38256161 AGGGCGGAGGGGAAGGGAGGGGG - Exonic
1116430376 14:44839324-44839346 AGTAACATGGGGAATGGGGGTGG - Intergenic
1116658067 14:47675359-47675381 TGGGGCTAGGGGAACGGGGGTGG + Intergenic
1117602442 14:57390124-57390146 AGGGGCAAGGAGGATGGGGGAGG - Intergenic
1117912127 14:60646738-60646760 ATCCCCAAGGGTAATGGGGGAGG + Intronic
1118342431 14:64906096-64906118 AGGGCCATGAGGAATTGGTGAGG + Intergenic
1118371117 14:65137880-65137902 TGGGCCACGGGGAAGGGCGGTGG - Intergenic
1118622992 14:67631124-67631146 AAGGTCAAGGGGGATGGTGGAGG - Intronic
1118725860 14:68628594-68628616 GGGGCGAAGGGGGCTGGGGGTGG + Intronic
1119630212 14:76224229-76224251 TGGGAAAAGGGGAATGGGGAAGG + Intronic
1119668889 14:76503985-76504007 TGGGCGAAATGGAATGGGGGAGG + Intergenic
1119857005 14:77908396-77908418 TGGGACAAGGGGGATGGGAGGGG - Intronic
1120931085 14:89849122-89849144 AGGGTGAAGGGTAATGGGAGTGG - Intronic
1122230534 14:100304560-100304582 AGGGCCTGGGGGCAGGGGGGTGG + Intronic
1122280183 14:100617567-100617589 AGGGAAAAGGGGAGTGGGGGAGG + Intergenic
1122366387 14:101197301-101197323 AGGGCCAGTGAGGATGGGGGTGG - Intergenic
1122396236 14:101434414-101434436 ATGGCCATGGGGAACTGGGGTGG - Intergenic
1122697209 14:103562073-103562095 AGGGCCAAGAGGGAAGGGCGAGG - Exonic
1122826172 14:104371757-104371779 AGTGCCAAGGGGGCTGGGGGAGG + Intergenic
1122978134 14:105179374-105179396 AGGGCCAAGGGACATTGGGCTGG - Intronic
1202851447 14_GL000225v1_random:23029-23051 GGGGCGAGGGGGAATGGGTGAGG - Intergenic
1202863541 14_GL000225v1_random:100483-100505 GGGGCGAAGGGGAAAGGGTGAGG + Intergenic
1124497500 15:30195633-30195655 AGGGGCGACGGGGATGGGGGCGG + Intergenic
1124818936 15:33023235-33023257 AGGGTAAAGGGGAAGGGGAGGGG + Intronic
1125099823 15:35899468-35899490 AGGGCCATGCGGGATGTGGGGGG - Intergenic
1125769739 15:42157212-42157234 GGGGGCAGGGGGCATGGGGGAGG - Intergenic
1127261753 15:57331620-57331642 AGGGCAAAGGGGAGTGAGGCAGG + Intergenic
1127518293 15:59717395-59717417 TGGGCCGAGGGGGTTGGGGGGGG - Intergenic
1127893739 15:63277360-63277382 AGGGCCTGGGGGACTGGGCGGGG - Intronic
1127975840 15:63996870-63996892 GGGGCAGAGGGGGATGGGGGTGG - Intronic
1128519288 15:68364885-68364907 AGGGTCAGGGAGAATCGGGGAGG - Intronic
1128790483 15:70429935-70429957 AGGCCCTAGGAGAATGGGTGTGG + Intergenic
1129150872 15:73687026-73687048 AGGGCCTAGGGGAGGGGGAGAGG + Intronic
1129661853 15:77557205-77557227 TGGGCCATGAGGGATGGGGGCGG + Intergenic
1130096779 15:80862039-80862061 AGGGCCAAGGGGAGCGCAGGAGG - Intronic
1130255378 15:82323473-82323495 AAGACCAAGGGGCATCGGGGGGG - Intergenic
1130646695 15:85734431-85734453 AGGGCCAGGTGGAATAAGGGAGG - Intronic
1131047160 15:89323565-89323587 AGGGCCATGGGGTAGGGGGTGGG + Intronic
1131215743 15:90533840-90533862 AGGCTCAGGGGGAGTGGGGGAGG + Intronic
1131743159 15:95416390-95416412 AGGGACAAGGTGAATGGGCCAGG + Intergenic
1132681381 16:1143686-1143708 AAGCCCAAAGGGAATGAGGGGGG + Intergenic
1132847493 16:2007183-2007205 AGGGCCATGGGGGACGGGAGCGG + Intronic
1132855487 16:2042885-2042907 AGGCGCTGGGGGAATGGGGGAGG - Intronic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1133586775 16:7203344-7203366 AGAGTCAAGGAGAATGGTGGTGG + Intronic
1133713302 16:8422550-8422572 AGGGCAAGAGGCAATGGGGGAGG - Intergenic
1134048745 16:11121997-11122019 AGGGACAAGGGGTATGGCAGAGG - Intronic
1135471249 16:22733179-22733201 AGGGCACAGTGGAAAGGGGGGGG - Intergenic
1135974259 16:27096983-27097005 AGGGCCAAGGGGCTGGGGAGTGG + Intergenic
1136020579 16:27437429-27437451 AGGGGCAGGGGGGATGGTGGTGG - Intronic
1136229388 16:28877785-28877807 AGAGCGATGGGGAAGGGGGGGGG + Intergenic
1137351732 16:47719216-47719238 AGGGCCATGTGGAGTGAGGGAGG - Intergenic
1137439234 16:48483897-48483919 AGGGGGAAGGGGAGAGGGGGAGG + Intergenic
1137489420 16:48919166-48919188 AGAGCCAAGGTTAATGGGGCTGG - Intergenic
1138108531 16:54305124-54305146 AGGGCGAAGGGGAAGGGGCAGGG - Intergenic
1138352591 16:56353873-56353895 AGGGGCAAGGGGCAGGGGGTTGG - Intronic
1138986471 16:62334749-62334771 GAGGCCAAGGGTAATGGAGGAGG + Intergenic
1139600492 16:67983602-67983624 AGGGTCATGGGGGTTGGGGGAGG + Intergenic
1139939141 16:70592036-70592058 AGTGGGAAGGGGCATGGGGGCGG + Intronic
1140412417 16:74748947-74748969 AGGCCCAGGGGGAAGGTGGGGGG + Intronic
1140424542 16:74849731-74849753 AGAGCGAAGTGGAGTGGGGGAGG + Intergenic
1140589508 16:76335085-76335107 AGGTCACAGGGGAATGGGGTGGG + Intronic
1140861510 16:79022564-79022586 AGGACAAAGAGGAATGGGGAAGG + Intronic
1141483070 16:84319604-84319626 AGGGAGAAGGGGACTGGGGCAGG - Intronic
1141667740 16:85474601-85474623 AGAGCAAGGGGGACTGGGGGAGG - Intergenic
1141696660 16:85623495-85623517 AAAACCAAGGGGAACGGGGGTGG - Intronic
1142228376 16:88888352-88888374 AGGCCCAAGGGGACTGGCTGGGG + Intronic
1143406926 17:6683892-6683914 ATGGCCAGGGGTAATGGGGGAGG - Intergenic
1143537266 17:7549033-7549055 AGGGGCAAGGGAAACGGGGCGGG - Exonic
1143622687 17:8089894-8089916 AGAGCAAAGGGGAATGTGAGGGG - Intergenic
1143651525 17:8266693-8266715 AGGGCCAAGGGAGTTGGGGCGGG - Intronic
1143872011 17:9963937-9963959 GAGGGCAAGGGGATTGGGGGAGG + Intronic
1144459466 17:15446439-15446461 AAGGCAAAGGGCAATGGGAGTGG + Intronic
1144788925 17:17846924-17846946 AGGGCCAAGGACAATTGGGAGGG - Exonic
1145783013 17:27576086-27576108 AAGGAGGAGGGGAATGGGGGTGG - Intronic
1145812430 17:27772513-27772535 GGGGACCAGGGGAATGGGAGGGG + Intronic
1145910452 17:28539156-28539178 AGAGGCAAGGGGTCTGGGGGAGG - Intronic
1146259379 17:31411746-31411768 AGGGCCAAGGGCCACAGGGGAGG - Intronic
1146623628 17:34419497-34419519 AGGGCCAAGGGCTATGGGTAGGG - Intergenic
1146958727 17:36954034-36954056 AAAGCCAAGGGGGATGGGGAGGG - Intronic
1147166497 17:38596252-38596274 AGGGCCATGGGCCATGGGGTTGG + Intronic
1147301872 17:39535869-39535891 AGGGCTAAGTGGAATGGGAATGG + Intronic
1147327247 17:39675311-39675333 AGGGCCCAGGGGAATGTTTGAGG + Intronic
1147363592 17:39946154-39946176 AGGGGCAAGGGGAAGGTGGGTGG + Intergenic
1147882898 17:43665372-43665394 AGGGCCATGGGGAGGGGGCGCGG + Intergenic
1148564497 17:48625259-48625281 CCGGCCAAGGGGAAGGGGGAGGG - Intronic
1148815813 17:50327193-50327215 AAGGCCACGGGGACTGGGGTAGG + Intergenic
1148899964 17:50867665-50867687 AGGGGAAAGGGGAAAGGGGAAGG - Intronic
1149172050 17:53823310-53823332 AGAGCCAAGGGGGATAAGGGCGG - Exonic
1149868180 17:60162034-60162056 AGGGACCAGGGGGATGGGGAGGG - Intronic
1150130571 17:62666690-62666712 AGGGCGATGGGGAGCGGGGGAGG + Intronic
1150392479 17:64798016-64798038 GGGGCCAGTGGGAATGGGAGTGG + Intergenic
1150941215 17:69696727-69696749 AGGGCTAAGGGGGTTGGTGGGGG - Intergenic
1151243589 17:72777254-72777276 AGGTCAAAGGGGACTGGGGCAGG + Intronic
1151679111 17:75614585-75614607 AGGGGCAAGGGGAATGGCCTCGG - Intergenic
1152109806 17:78351741-78351763 AGGGCCAAGGGAAGAGGAGGAGG - Intergenic
1152298252 17:79480789-79480811 AAGACCACGGGGAATGGTGGGGG - Intronic
1152434139 17:80264815-80264837 GGAGCCAAGAGGAATGGGGTGGG - Intronic
1152595706 17:81236652-81236674 AGGGCTTTGGAGAATGGGGGAGG - Intronic
1154112855 18:11585385-11585407 AGGGCCAAGGGAAATAGCGCAGG - Intergenic
1154322901 18:13368879-13368901 AGGGCCATGGGGAAGGTGGCAGG + Intronic
1154435806 18:14340861-14340883 AGGGCCAAGGGGAACCAGGGGGG + Intergenic
1155223398 18:23705916-23705938 AGAGACAGAGGGAATGGGGGTGG - Intronic
1156609659 18:38711469-38711491 TGGGACAAGGTGAGTGGGGGAGG + Intergenic
1156661990 18:39357254-39357276 ATGGCAAAGGGGAATATGGGGGG - Intergenic
1156781025 18:40851076-40851098 AGGAACAAGGTGAATGGGAGTGG - Intergenic
1156921589 18:42529153-42529175 AGTGTCCTGGGGAATGGGGGAGG - Intergenic
1157440764 18:47709862-47709884 AGGGCCAATGGGACTGAGGTTGG - Intergenic
1157811634 18:50701178-50701200 ATGGCCAAGGAGGATGGGGGTGG - Intronic
1157979314 18:52362781-52362803 AGGGAGGAGGGGAGTGGGGGGGG - Intronic
1159037402 18:63290880-63290902 AGGGCCGAGTGGGATGAGGGTGG - Intronic
1159961290 18:74557540-74557562 AGAGCCTAGGAGAGTGGGGGTGG - Intronic
1160108862 18:76006199-76006221 AGGGGCAAGGGGTGTGGAGGTGG - Intergenic
1160580895 18:79884214-79884236 AGGGACATGGGGCATGGGGAGGG - Intronic
1160946127 19:1644844-1644866 GAGGCCCAGGAGAATGGGGGTGG + Intronic
1161347217 19:3774385-3774407 AGGGACAATGGGAAGGGGAGAGG + Intergenic
1162022430 19:7873986-7874008 AGGGGCAAGGGGCAGGGGCGTGG - Intronic
1162096305 19:8311913-8311935 AGGGGCAGCAGGAATGGGGGTGG - Intronic
1162180374 19:8864710-8864732 AGGGGCTGGGGGCATGGGGGTGG + Intronic
1162406676 19:10479032-10479054 AGGGCTAAGGGGCGGGGGGGCGG + Intergenic
1162450816 19:10753409-10753431 AGGGGAAAGGGAAGTGGGGGGGG - Intronic
1162971677 19:14184325-14184347 GGGGCCAGGGGAGATGGGGGAGG + Intronic
1163027353 19:14519921-14519943 AGGGCCCAGGGAAGTGGGGGAGG + Intronic
1163325400 19:16600154-16600176 AGGGCCCGGGGGGATGAGGGGGG - Intronic
1163327591 19:16615069-16615091 TGCTTCAAGGGGAATGGGGGTGG + Intronic
1163527688 19:17831183-17831205 AGAGCCGTGGGGAATAGGGGCGG + Intronic
1163729476 19:18940976-18940998 AGGGCCAAGGGGAGGGCGTGGGG - Intronic
1163741129 19:19013573-19013595 AGGCACAAGGGGAAGGAGGGAGG - Intronic
1163944706 19:20524185-20524207 AGAGCGAAGGGAAATAGGGGTGG + Intergenic
1164414831 19:28038321-28038343 AGGGCCAGAGGGCAAGGGGGTGG - Intergenic
1164458281 19:28426959-28426981 AGGGGCAGGGGGGAGGGGGGAGG + Intergenic
1164680544 19:30131170-30131192 AGGGGGAAGGGGAAAGAGGGAGG - Intergenic
1164753545 19:30673074-30673096 ATGGCCCAGGGGAATGGGTGAGG + Intronic
1164826845 19:31290258-31290280 AGGGCCAGGGGGAATGTGTTTGG - Intronic
1164884798 19:31769522-31769544 TGGGCCAGGGGGTATGTGGGGGG + Intergenic
1165482582 19:36073538-36073560 AGGGGCAAGGGGGTGGGGGGGGG - Intronic
1165796776 19:38524248-38524270 GAGGTCAAGGGTAATGGGGGTGG + Intronic
1165808394 19:38596032-38596054 TGGGGAAAGGGGAATGGGGTGGG - Intronic
1166113998 19:40641574-40641596 AGGGCCATGGAGAATCTGGGAGG + Intergenic
1166212071 19:41313206-41313228 AGGGCACAGGGGAGTGGGAGAGG - Intronic
1166299005 19:41903810-41903832 TGGGCCAAGGAGTAGGGGGGCGG - Intronic
1166333347 19:42091219-42091241 AGGGACCAGAGGAATGGGAGGGG + Exonic
1166381796 19:42358624-42358646 AAGGCCAAGGAGAATGTGTGTGG + Intronic
1166531754 19:43547007-43547029 AGGCCCAAGGGAAGTGGGGAGGG + Intronic
1166888533 19:45975491-45975513 AGAGCCAAGGGGGATGGGAGGGG + Intergenic
1166892446 19:46001703-46001725 AGGCCCAAGGGCAATGGCGTAGG - Intronic
1167240792 19:48342080-48342102 AGGGAGAAAGGGAAGGGGGGAGG + Intronic
1167420400 19:49399347-49399369 AGGGCCTGGGGGAATGGGTCTGG - Intronic
1167430762 19:49453208-49453230 GGGGCTAATGGGAATGGGGTGGG - Exonic
1167579380 19:50332853-50332875 AGGGCCTGGGGTAATGGGGGAGG - Intronic
1168007960 19:53506366-53506388 AGGGGCCAGGACAATGGGGGAGG - Intergenic
1168165367 19:54543467-54543489 AGGGGCACTGGGAATGGGAGGGG - Intronic
1168286842 19:55339500-55339522 AGGTCCAAGTGGAAAGAGGGCGG - Intergenic
1168296655 19:55380323-55380345 AGGGGGAAGGGGGAAGGGGGAGG - Intronic
1168357933 19:55713782-55713804 AGGGACGAGGGGAAGGGGGGAGG - Intronic
925181509 2:1820017-1820039 AGGGCAGAGGGCAGTGGGGGGGG + Intronic
926033918 2:9618924-9618946 AGGACTAAGGGGAAGGGTGGAGG - Intronic
926240463 2:11081130-11081152 AGGGGGAAGGGGGAGGGGGGAGG - Intergenic
926719555 2:15949608-15949630 AGGGCCATGGGCAATGGAGCTGG - Intergenic
926751044 2:16198794-16198816 AGGGGCTGGGGTAATGGGGGAGG + Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
929444482 2:41991902-41991924 AGGGAGAAGGGGAAGGGGAGGGG + Intergenic
929511360 2:42568457-42568479 GGGGCCAGCGGGAATTGGGGGGG - Intronic
929551378 2:42895304-42895326 AGGGCCAGGGGCAGTGTGGGAGG - Intergenic
929664380 2:43822480-43822502 AGGACCCAGGTGCATGGGGGGGG - Intronic
929829435 2:45335081-45335103 AGGGCCAAGGGGCAGGGGTGAGG + Intergenic
929852412 2:45604371-45604393 AGGGGAGAGGGGAAGGGGGGTGG + Intronic
930642007 2:53862896-53862918 AGGGAAAAGGAGAAAGGGGGTGG - Intergenic
930657717 2:54022785-54022807 AGAGACAAGGGGAATGGAGAGGG - Intronic
931241705 2:60460332-60460354 AGGGCGATGGGGAAGGGGAGTGG + Exonic
931778053 2:65556779-65556801 AGGGCCTTGGGGAAGTGGGGTGG + Intergenic
932003384 2:67905300-67905322 AGAGCCAAGGGAAATGGGATGGG - Intergenic
932343733 2:70982423-70982445 AGGGCCCCGGGCAATGGGGATGG + Intronic
932492280 2:72130069-72130091 AGGGGCAGGGGGCATGGGGCTGG - Exonic
932573022 2:72947830-72947852 AGGGTGGAGGGGACTGGGGGTGG - Intronic
932585091 2:73022624-73022646 AGGGGGAAGGGGGAAGGGGGAGG + Intronic
932614360 2:73222671-73222693 AGGGCCCAGGCGACTAGGGGAGG - Intronic
932627485 2:73309119-73309141 AGGGACAAGGGGCATGAGGAAGG - Intergenic
932780011 2:74554010-74554032 AGGGCTCAGGGGGATGTGGGAGG - Intronic
933772572 2:85753710-85753732 TGGGCCAAGGGGATGGGGGTGGG + Intronic
933938518 2:87226277-87226299 AGGGCAATGGGCAATGGGAGTGG - Intergenic
935073804 2:99720424-99720446 AGGGCAAAGGGGAAATGGGCAGG - Intronic
935580268 2:104750321-104750343 AGGGGCAAGGGGGCTGGGAGGGG + Intergenic
936097937 2:109548130-109548152 AGGTCCAAGGAGAATGTAGGTGG + Intronic
936140101 2:109932132-109932154 AGGCCCAAGGGAGAAGGGGGAGG - Intergenic
936176790 2:110230077-110230099 AGGCCCAAGGGAGAAGGGGGAGG - Intergenic
936204595 2:110439354-110439376 AGGCCCAAGGGAGAAGGGGGAGG + Intronic
936354617 2:111739497-111739519 AGGGCAATGGGCAATGGGAGTGG + Intergenic
936433327 2:112482509-112482531 AGGGCAGACGGGAATCGGGGAGG - Intronic
936491452 2:112976228-112976250 AGGACCAAGTGGAATGAGGGCGG + Intronic
937086516 2:119175330-119175352 AGTGCCAAGGGGAGTAGGTGAGG + Intergenic
937630610 2:124097488-124097510 AGTGGCGAGGGGAATGGGAGAGG - Intronic
938143357 2:128813554-128813576 GGAGCCAAGGGGAATGGGCAGGG - Intergenic
938173134 2:129100810-129100832 AGGGACAAGGGTCATGGGGCAGG - Intergenic
938329124 2:130436815-130436837 GGGGGCTAGGGGAGTGGGGGAGG - Intergenic
938360821 2:130684678-130684700 GGGGGCTAGGGGAGTGGGGGAGG + Intergenic
938969717 2:136421055-136421077 AGGGCCACAGGGTATGAGGGTGG + Intergenic
939255147 2:139733659-139733681 AAGACCAAGGGGGGTGGGGGAGG + Intergenic
939679567 2:145113824-145113846 AAAGGAAAGGGGAATGGGGGAGG + Intergenic
939874525 2:147562541-147562563 GGGGCCAAGGGGAGAGGGGAAGG - Intergenic
940194378 2:151077204-151077226 AGGGCCTAGGGTTATGGGGGAGG + Intergenic
940763524 2:157764591-157764613 AGGGCGAAGGCGGATGGGGTTGG - Intronic
942013891 2:171791735-171791757 ATGTGCAAGGGAAATGGGGGAGG + Intronic
942607818 2:177710424-177710446 AGAGCAATGGGGAATGGGGCTGG + Intronic
943161132 2:184252647-184252669 AGGGTCGTGGGGCATGGGGGAGG + Intergenic
945216823 2:207442982-207443004 AGGCCCAAGGGAAGTGGGAGAGG + Intergenic
946172977 2:217906271-217906293 GTGGCCAGGGGGAATGGGGTGGG - Intronic
946174128 2:217912292-217912314 AGGGCCGAGGGGAAGGGGATTGG + Intronic
946365973 2:219249291-219249313 AGGGGCGAGGGGAGTGGAGGTGG + Exonic
946409082 2:219507576-219507598 AGGGCCAGGGGGACAGGAGGTGG - Intergenic
946519062 2:220446576-220446598 AGGGGAAGGGGGAAGGGGGGAGG - Intergenic
946881296 2:224179721-224179743 AGGGGGAAGGGGACTGAGGGTGG + Intergenic
947119355 2:226799568-226799590 AGGGCGAGAGGGGATGGGGGAGG + Exonic
948162120 2:235833489-235833511 AGGGCCTTGGAGAGTGGGGGTGG - Intronic
948283815 2:236769028-236769050 GGAGCCAAGGGGAATAGGGAGGG + Intergenic
948378425 2:237537359-237537381 AGAGCGACGGGGTATGGGGGTGG - Intronic
948753398 2:240145034-240145056 ATGGGCCAGGGGGATGGGGGCGG - Intergenic
948889084 2:240898085-240898107 AGGGCCAAGGGGCAAGGATGGGG - Intergenic
949049961 2:241892367-241892389 AGGGGCAAGGGGAAGAGGGATGG - Intergenic
1168771703 20:420366-420388 GGGTCCAAGGGGAATGCAGGTGG - Intronic
1169426111 20:5498636-5498658 AATGCCAAGGGGAATGGGGGTGG - Intergenic
1169469516 20:5871808-5871830 AGGGGGAAGGGGGAAGGGGGAGG + Intergenic
1169487804 20:6047964-6047986 AGGGTCAAAGGGAAGGGGGCTGG + Intronic
1170036132 20:11992181-11992203 AAGGCCAAGGCAAATGGGGGAGG - Intergenic
1170587489 20:17745700-17745722 GGGGGCAGGGGGAATGAGGGGGG + Intergenic
1171265564 20:23769334-23769356 TGGGCCAAGGGGAAATGGGAAGG - Intergenic
1171968027 20:31545080-31545102 AGAGACAAAGGGAATGGTGGAGG - Intronic
1172113990 20:32563073-32563095 AGGGTGAAGGGGAAGGAGGGTGG + Intronic
1172654790 20:36530045-36530067 TGGGCCATGGGGATTGGGGATGG + Intergenic
1172762813 20:37333897-37333919 AAGGCCAAGGGGAAGGGGAAGGG + Intergenic
1172807720 20:37624514-37624536 AGGCCCAAGGGGAAGGGTGGGGG - Intergenic
1173605368 20:44327356-44327378 AGGGGCTTGGGGGATGGGGGTGG - Intergenic
1173687414 20:44933198-44933220 AGGGCCAAGGGGAATGGGGGTGG + Intronic
1173767861 20:45630367-45630389 AGGGGCAAGGAGAGTGGTGGTGG + Intronic
1174088373 20:48026639-48026661 TGGGCAAAGGGGAATGTGTGAGG + Intergenic
1174346587 20:49934955-49934977 AGGGCCTGGGGGTATGGGGATGG + Intergenic
1174435762 20:50505643-50505665 AGGGCAGAGGGAAATGGGGCAGG + Intergenic
1174467614 20:50730285-50730307 AGGGGGCAGGGGAATGGAGGTGG - Intergenic
1174687450 20:52469240-52469262 GGGGCCAAGAGGAATGGCTGAGG + Intergenic
1175888450 20:62305299-62305321 AGTGCCAAGGGGGGTGGGGTGGG - Intronic
1176081033 20:63273081-63273103 AGCGCCGAGGGAACTGGGGGAGG - Intronic
1176301126 21:5099557-5099579 AGGGCCCAGGGAAAGGGAGGTGG - Intergenic
1178055078 21:28789432-28789454 AGGCCTAAGGGGCATGGGAGAGG + Intergenic
1178719746 21:34998011-34998033 AGAGGCAAGGGAGATGGGGGAGG - Intronic
1179196568 21:39169625-39169647 AGGGCCTGGGGTAATTGGGGAGG - Intergenic
1179631317 21:42680312-42680334 ATGGCCAAGGGGACTGGAGCAGG - Intronic
1179855903 21:44162341-44162363 AGGGCCCAGGGAAAGGGAGGTGG + Intergenic
1179958225 21:44752688-44752710 AGGGACAAAGGGAAAGAGGGGGG + Intergenic
1180226365 21:46394962-46394984 AGGGCCAGGGGCACTGGGGCAGG - Intronic
1180703504 22:17794614-17794636 AGGGCCAGAAGGAAAGGGGGTGG - Intronic
1181283499 22:21736061-21736083 AGGGCCGAGGGACACGGGGGCGG + Intergenic
1181325321 22:22040308-22040330 ATGGGCAAGGGGGCTGGGGGAGG + Intergenic
1181711709 22:24695575-24695597 AGGGCTGAGAGGAATGGAGGCGG + Intergenic
1181807839 22:25385719-25385741 GGGGCCAACAGGAATGGGGGTGG - Intronic
1181982513 22:26775479-26775501 AGGAGCAAGGGGGATGGTGGGGG + Intergenic
1182421566 22:30251027-30251049 AGGGCCAGAGGGGATGGGGAAGG - Intergenic
1182451237 22:30423156-30423178 AGGGCCAGGGAGGTTGGGGGTGG + Exonic
1183196778 22:36358918-36358940 AGGGGCAAGATGAATGGGTGGGG - Intronic
1183255055 22:36756685-36756707 AGGGCCATGGGGAAGGGGGCTGG + Intergenic
1183476584 22:38039064-38039086 AGGGCCGCGGGAAATGGCGGAGG - Intronic
1183666518 22:39249321-39249343 AGGGCCACGCGGAGTGGGGTAGG - Intergenic
1184200474 22:42965261-42965283 AGGGCCAGGGGGCAGGGTGGGGG + Intronic
1184266246 22:43348084-43348106 AGGGCTGAGGGGCGTGGGGGTGG + Intergenic
1184376602 22:44117378-44117400 TGGGCCATGGGGGGTGGGGGAGG + Intronic
1184421173 22:44383771-44383793 GGGGCCAAGGGCAAAGGGGAGGG - Intergenic
1184561950 22:45268633-45268655 AGGGGCGGGAGGAATGGGGGCGG - Intergenic
1184652036 22:45923872-45923894 AAGGCCAAGGGGAGCAGGGGAGG + Intronic
1184880582 22:47301995-47302017 AGGGCCAGGGGGCATAGGGATGG + Intergenic
1185229812 22:49673560-49673582 AGGGGGAAGGGGAAGGGGGAGGG + Intergenic
950102436 3:10366243-10366265 AGGGCCGAGGAGAAAGGGGAAGG - Intronic
950429152 3:12940985-12941007 AGGGCCAAGGCCCCTGGGGGAGG + Intronic
950543976 3:13628079-13628101 AGGGACAAGGGGGCTGGGAGAGG - Intronic
950574637 3:13824689-13824711 AGGGCCAAGAGGCATGGAAGGGG - Intronic
950640395 3:14344767-14344789 ATGCCCAAGAGGAATGGAGGGGG + Intergenic
950646708 3:14381708-14381730 TTGGCCAAGAGGAAAGGGGGCGG + Intergenic
950743643 3:15069433-15069455 AGGGCAATGGGGAATGAGGTTGG - Intergenic
950991488 3:17442896-17442918 AGGGACAAGGGAAGTGGGAGGGG + Intronic
951719144 3:25679637-25679659 AAGGGCGAGGGGAAAGGGGGAGG + Intergenic
952238950 3:31510001-31510023 AGGGCCACTGGGAATGAGGCAGG - Intergenic
953150433 3:40319645-40319667 AGTGCCAAGGGATATGGGTGAGG - Intergenic
953211342 3:40877850-40877872 AGGTGCAAGCTGAATGGGGGTGG - Intergenic
953449487 3:42994353-42994375 CGGGCCTAGGGGGATGGGGAAGG + Intronic
953982027 3:47417919-47417941 AGGGGCAAGGGAAAAGGGGGTGG + Intronic
954431411 3:50472764-50472786 GGGTGCATGGGGAATGGGGGTGG - Intronic
954653335 3:52178541-52178563 TGGGCCAAGGGGAGTGGAAGGGG + Intergenic
954685231 3:52366653-52366675 GGGGCCAAGGGGAGGGGGAGGGG - Intronic
954900855 3:54018358-54018380 AGGGCCTTCGGGAGTGGGGGTGG + Intergenic
955406559 3:58629393-58629415 ATGGGCAGGAGGAATGGGGGTGG + Intergenic
955710011 3:61768787-61768809 AGGGAAGAGGGGTATGGGGGAGG + Intronic
955885797 3:63596670-63596692 CAGGCCAAGAGGAATGTGGGAGG + Intronic
955979035 3:64506100-64506122 TGGGGCAAGGGGATGGGGGGAGG + Intergenic
956073877 3:65484294-65484316 TGGTCCAAGGTAAATGGGGGTGG + Intronic
958642883 3:96830767-96830789 AGGGGTAAGGGGAAATGGGGGGG + Intronic
959539742 3:107524810-107524832 GGGGCGAAGGGGAAGGTGGGTGG + Intronic
960846590 3:122009613-122009635 AGGGCCAAGGAGAAAGAGGTTGG + Intronic
961028872 3:123584981-123585003 GCAGCGAAGGGGAATGGGGGCGG - Exonic
961048010 3:123722525-123722547 GGGGCCTAGAGGGATGGGGGAGG + Intronic
961097716 3:124172233-124172255 AAGGCGAAGGGGAATGGGGTAGG - Intronic
961118861 3:124356158-124356180 GGGGTCGAGGGGAATGGAGGAGG - Intronic
961145021 3:124586258-124586280 ATGGCCAAGGGGAATCTGAGTGG + Intronic
961378593 3:126482858-126482880 ATGGCAGAGGGGAATGGGGGAGG - Intronic
961440891 3:126952592-126952614 GGGGCCCAGGGGAGTGGGGCAGG + Intronic
962279426 3:134039010-134039032 AGTGCCAAGAGCACTGGGGGTGG + Intronic
963053756 3:141165608-141165630 AGGGGCAAGGAGAATGGATGGGG + Intergenic
966891018 3:184407688-184407710 AGGGCCACGTGGACTGGGAGAGG - Intronic
967176442 3:186865321-186865343 AGGGTTAAGTGGATTGGGGGCGG + Intergenic
968131004 3:196192777-196192799 AGGAGCAAGGGGAAGGGAGGAGG + Intergenic
968360747 3:198145128-198145150 GGGGCCATGGGGATTGGGTGGGG - Intergenic
968575731 4:1365225-1365247 AGGGCCAAGAAGAACTGGGGAGG - Intronic
968603060 4:1519496-1519518 AGGGCCACTGGGCCTGGGGGCGG + Intergenic
968704905 4:2073265-2073287 AGGGCCAAGGGGCCTGCGAGAGG - Intronic
968756227 4:2417824-2417846 CGGGCCCAGGACAATGGGGGTGG + Intronic
968812379 4:2805797-2805819 GGGGCCAAGGGGCAAGGGCGGGG + Intronic
969281086 4:6171073-6171095 AGTGAGAAGGGTAATGGGGGTGG - Intronic
969862491 4:10048514-10048536 AGGGCCCAGGGAAATGAGCGTGG - Intronic
970114707 4:12681769-12681791 ATGGCCAAGAGGTTTGGGGGAGG - Intergenic
970864663 4:20744617-20744639 AGGGGTCAGGGGGATGGGGGAGG + Intronic
971636645 4:29068717-29068739 AGGGAGAAGGGGAAAGGGGAGGG - Intergenic
973533030 4:51851679-51851701 GGAGCAAAGGGGAATGGGGAGGG + Intronic
975360227 4:73460956-73460978 AGGGGGGAGGGGGATGGGGGAGG - Intergenic
975570943 4:75817173-75817195 AGGGGTAAGGGGAACTGGGGAGG + Intergenic
975664537 4:76721835-76721857 AGGGGCAAGAGAAATGGGTGTGG + Intronic
976133461 4:81909421-81909443 AGGTTCATGGGGAATGGGGGTGG + Intronic
976813352 4:89120407-89120429 AGGCCAAATGGGAATGGAGGTGG + Intergenic
978800980 4:112755126-112755148 GGGGCCCAGGGGATTGGAGGGGG - Intergenic
979349472 4:119628076-119628098 AGGGCGAGGGGGGACGGGGGAGG + Intronic
981005038 4:139865979-139866001 ATGGCCAAGGGGCATGCAGGTGG + Intronic
981804743 4:148701675-148701697 GGGGGAGAGGGGAATGGGGGAGG - Intergenic
982894255 4:160897205-160897227 AGGGTCAAGGGATATGGGGCTGG - Intergenic
983367792 4:166816868-166816890 AGGGCCCAGTGCAATGGGAGGGG + Intronic
983570807 4:169206383-169206405 AGGGGCTGGGGGAAGGGGGGTGG + Intronic
984698715 4:182804683-182804705 AGTGCCCATGGGAAGGGGGGCGG - Intergenic
984911437 4:184676929-184676951 AGGGAGAAGGGGAAGGGGGAAGG - Intronic
984952388 4:185017183-185017205 GGGCCCAAGGGGAAGGAGGGGGG - Intergenic
985529148 5:423806-423828 GGGGCCAAGGGGCGTGGCGGTGG - Intronic
985576865 5:677644-677666 CGGGCCATGGGGAGTGGAGGGGG - Intronic
986127397 5:4895693-4895715 AGGGATAAGGGGTGTGGGGGCGG - Intergenic
986668071 5:10120412-10120434 AGGTCCAAGGGGAAGGGCGAAGG + Intergenic
987332266 5:16867465-16867487 AGGGGCAAAGGGAAGGGGAGGGG + Intronic
988727569 5:33939308-33939330 ATGTGCAAGGGGAATTGGGGCGG + Intergenic
990589639 5:57249744-57249766 AGGGGGAGGGGGAAGGGGGGAGG - Intronic
990782387 5:59379968-59379990 AGGGGAAAGGGGAATAAGGGAGG - Intronic
991144186 5:63282140-63282162 ATGGCCGGGGGGAATGGGGGAGG - Intergenic
991163154 5:63529138-63529160 TGTGTCAAGGGGAATGGGGTGGG - Intergenic
991329636 5:65480321-65480343 TGGGCGAAGTGGAATGGTGGGGG - Intronic
991918853 5:71633358-71633380 AGTCCCAAGGGGAATAGGGGAGG - Intronic
992608542 5:78487165-78487187 AGGGCTAAGGGCAAAAGGGGTGG - Exonic
992671817 5:79069312-79069334 CTGGCCAAGGGGATTGGGGCAGG + Intronic
993105336 5:83593722-83593744 AGCGTCAAGGGGAGTGGGGAGGG - Intergenic
993779096 5:92043204-92043226 AGGGACAAGTGGAATGAAGGAGG - Intergenic
993901150 5:93584922-93584944 AAGGGGAAGGGGAAGGGGGGAGG - Exonic
993967412 5:94374721-94374743 AGGGCGAAGGAGGATTGGGGAGG - Intronic
996552365 5:124744253-124744275 GGGGCCAAGAGCAATGGAGGTGG - Exonic
996873256 5:128215429-128215451 AGGGCCAAGGGGTAGGAGGCAGG - Intergenic
997591019 5:135072410-135072432 AGGGCCAAAGGTAAAGGGTGAGG + Intronic
999044740 5:148454853-148454875 AGGGGCAAGAGCAATGGGGAAGG - Intronic
1000258063 5:159559860-159559882 GGGGTCAGGGGGAATGGAGGAGG - Intergenic
1000497168 5:161999101-161999123 GGAGCCAAGGAGAATGAGGGAGG - Intergenic
1001104798 5:168843982-168844004 AGGGGCCAGGGGTAGGGGGGCGG - Intronic
1001303147 5:170552595-170552617 AGGGAGAAGGGGAGTGAGGGTGG + Intronic
1001647867 5:173295474-173295496 AGGGCCATGGGGGAGGGGGGAGG + Intergenic
1001964464 5:175900693-175900715 AGGGCGAAGGGGCATGGGACTGG - Intergenic
1002415219 5:179116923-179116945 AGTGCCAAGGAGGAAGGGGGAGG + Intronic
1002585597 5:180245035-180245057 AGGGACAAAGGGAATAGGGAAGG - Intronic
1002928681 6:1619457-1619479 AGGGGGGAGGGGGATGGGGGTGG - Intergenic
1003700058 6:8453845-8453867 TTGGCAAAGGGGAATGGGGAGGG - Intergenic
1003977936 6:11361457-11361479 AGTGTCAAGGGGCAGGGGGGAGG + Intronic
1004017237 6:11743471-11743493 AAGGCCAAGGGGGCTGAGGGAGG - Intronic
1004128543 6:12897615-12897637 AGGGCTTAGTGGAATGGGAGAGG - Intronic
1004562182 6:16761235-16761257 AGGGGAGAAGGGAATGGGGGAGG + Intronic
1006082038 6:31573252-31573274 AGAGCCATAGGGGATGGGGGTGG - Intronic
1006262526 6:32887162-32887184 AGGTCCAAGGGCACTGAGGGAGG - Intergenic
1006271368 6:32969277-32969299 AGGGCAAAGGGGTTAGGGGGCGG + Intronic
1006324773 6:33345504-33345526 TGGGGCCGGGGGAATGGGGGGGG - Intergenic
1006757236 6:36426935-36426957 AGGGGAAAAGGGAAAGGGGGCGG - Intronic
1007110499 6:39310858-39310880 TGGGGCCAGGGGGATGGGGGTGG - Intronic
1007782559 6:44262939-44262961 AGGGCAAAGAGGAGTGGGTGTGG - Intronic
1008543320 6:52564519-52564541 AGGCTCAAGGGGCATGGGGCAGG - Intronic
1008824461 6:55676521-55676543 AGGGCCATGGAGAAGGGGTGAGG - Intergenic
1009508168 6:64512477-64512499 ATGGCCCAGGGGAAGGGGGAGGG + Intronic
1011277489 6:85643897-85643919 GGGGCCAAGGGGGAGGGGAGCGG + Intergenic
1013000562 6:106017866-106017888 AGGGTCAGGGGGAGTGTGGGTGG + Intergenic
1013096741 6:106952258-106952280 AGGGACCAGGGCAATGGGGGCGG + Intergenic
1013740612 6:113279627-113279649 ATGCCAAAGGGGCATGGGGGAGG + Intergenic
1014575147 6:123060094-123060116 AGGGCCAAGGGGAATCAGTGTGG - Intronic
1015266051 6:131293497-131293519 ACAGCCAAGGGGAATGGTGGTGG + Intergenic
1015645214 6:135379941-135379963 AGGGAGAAGGGGAAGGAGGGAGG - Intronic
1016567265 6:145470036-145470058 AGGGGTAGGGGGAATGGGGATGG + Intergenic
1017724873 6:157269812-157269834 TGAGCCAAGGGTAATGAGGGAGG - Intergenic
1017981699 6:159406522-159406544 AGAGCCAAGGTGAATGAAGGGGG - Intergenic
1018429854 6:163713949-163713971 AGGGCAGAGGGGAATGTCGGGGG + Intergenic
1018461681 6:164004717-164004739 AGGGGGAGGGGGGATGGGGGAGG + Intergenic
1018869534 6:167770493-167770515 AAGGCCAAGGAGAAAGGAGGGGG - Intergenic
1018902142 6:168057025-168057047 AGGGCCATGTGGAAGTGGGGTGG + Exonic
1019408128 7:894551-894573 AGGGCCAGGGTGTCTGGGGGGGG - Intronic
1019999904 7:4749721-4749743 AGAGCCAAGGGCATTGAGGGTGG + Intronic
1020261145 7:6531359-6531381 AGAGCCAAGGGGAGTGAGCGCGG - Intronic
1020274916 7:6617958-6617980 AGGACCAAGGGAATTGGAGGGGG + Intronic
1020834466 7:13131804-13131826 AGGGCAAAGGGATATGGGTGTGG + Intergenic
1021432916 7:20581944-20581966 AGGGCAAGGCAGAATGGGGGAGG + Intergenic
1022502677 7:30892505-30892527 AGGCCCCAGGAGAATGGAGGTGG + Intergenic
1023152364 7:37214131-37214153 AGGGGTGAGGGGATTGGGGGTGG - Intronic
1023661621 7:42476723-42476745 AGGTCCAAGGGGAGTTGGTGGGG - Intergenic
1023867935 7:44247605-44247627 AGGGTCAAGGCGGCTGGGGGTGG + Intronic
1024030299 7:45455041-45455063 AGGGAGTAGGGGGATGGGGGAGG - Intergenic
1024051181 7:45624342-45624364 AGGGGCAGGGGGAAGGAGGGTGG + Intronic
1025777355 7:64570509-64570531 AGGGGCAAGGGGGAGGGGGAAGG + Intergenic
1026308766 7:69166140-69166162 AGGGAAGAGGGGAAAGGGGGGGG + Intergenic
1027249356 7:76389502-76389524 CTGGACAAGGGGACTGGGGGAGG - Exonic
1028354999 7:89896616-89896638 GGGGGCAGGGGGGATGGGGGAGG - Intergenic
1028872710 7:95786761-95786783 GGGGCCAAGGGGAAGGAGGATGG - Intronic
1029001218 7:97156963-97156985 AGGGGCTGGGGGACTGGGGGAGG - Intronic
1029536974 7:101162878-101162900 AGGGCCAAGGGGCAGGGCCGGGG + Exonic
1031064596 7:117091253-117091275 AGGGCCAAGGGCAAGGAGAGGGG + Intronic
1031392704 7:121235411-121235433 AGGAACAAGAGGAATGGTGGGGG - Intronic
1031426366 7:121610394-121610416 AGTGCCAAGGGATATGGGTGGGG - Intergenic
1031457748 7:122004343-122004365 AGGGGCAGGGGAAATGGGGAAGG + Intronic
1032535219 7:132657404-132657426 AGGGCCCAGGTGCATGGAGGAGG + Intronic
1033804365 7:144937531-144937553 AGGGGGAAGGGGAAGGGGGAAGG - Intergenic
1034418602 7:150977824-150977846 AGGGCCAGAGTGAGTGGGGGAGG - Exonic
1034717578 7:153257464-153257486 ATGGATAAAGGGAATGGGGGTGG + Intergenic
1035400460 7:158561855-158561877 AGGGCCACGGGCAGTGGGGATGG - Intronic
1036779489 8:11635589-11635611 TGGGCCATGGGGAAGGGTGGAGG + Intergenic
1036791904 8:11726609-11726631 AGCCCCCAGGGGAGTGGGGGCGG + Intronic
1037322828 8:17659881-17659903 AGGGCCTTGGGGAAGGGGAGGGG - Intronic
1037481380 8:19308977-19308999 AGGGCCAGAGGGAATGTCGGGGG + Intergenic
1037654821 8:20873838-20873860 AGGGCCAAAGTTAATGTGGGTGG - Intergenic
1037659698 8:20916183-20916205 AGGCCGGAGGGGCATGGGGGAGG - Intergenic
1037747545 8:21659024-21659046 AGGGCCAAGGGGAGATTGGGAGG - Intergenic
1037877146 8:22553903-22553925 AGGGCCAAGGGGAGCGTCGGGGG - Intronic
1037886652 8:22599391-22599413 AGGGGCGAGGGGAAGGGGGAGGG - Intronic
1038622148 8:29154386-29154408 AGGGCAGAGGGGAAGAGGGGAGG + Intronic
1038653044 8:29422911-29422933 AAGGCCAAGGGGTTTGGGGTAGG + Intergenic
1038922493 8:32100095-32100117 AGGGGGAAGGGGAAGAGGGGAGG - Intronic
1039450801 8:37673576-37673598 AAGGCCAAGGGATATGTGGGAGG - Intergenic
1039601487 8:38842085-38842107 AGGGTAAGGAGGAATGGGGGCGG - Intronic
1039793111 8:40891245-40891267 AGGGGGAAGGGGGAGGGGGGAGG + Intronic
1039923614 8:41909928-41909950 AGGGCCAAAGGGAAGGGTGATGG + Intergenic
1040521573 8:48180766-48180788 ATGGCCATAGGGAATGGAGGTGG - Intergenic
1042312932 8:67396600-67396622 TGGGACTAGGGGGATGGGGGTGG - Intergenic
1042796095 8:72665012-72665034 AAGGCCAAGGGGAAAGGAAGTGG + Intronic
1043417410 8:80065416-80065438 CGTTCCAAGGGGAATGGGTGCGG - Intronic
1043817544 8:84820694-84820716 GGGGGCAAGGGGAAAGGGGAGGG - Intronic
1044301000 8:90582794-90582816 AGGGAAAAAGGGAGTGGGGGAGG - Intergenic
1044547644 8:93477329-93477351 AGGGCCAAGGGGAGTGAGGTGGG - Intergenic
1044927937 8:97224818-97224840 GGGGCCAAGGGGAAAGGGGCTGG + Intergenic
1045237993 8:100373254-100373276 AGAGCCAAAGAGAATGAGGGAGG - Intronic
1047189384 8:122664068-122664090 AGGTCCAAGGGGAATGGAAAGGG - Intergenic
1047498077 8:125422598-125422620 AGGGCCAAGGGGTGTGTGTGGGG + Intergenic
1047506656 8:125485838-125485860 AGAGCCCAGGGGTGTGGGGGAGG - Intergenic
1048699638 8:137074522-137074544 AGGGGCTGGGGGACTGGGGGAGG - Intergenic
1049306252 8:141905864-141905886 TTGGCCAAGGGGCGTGGGGGCGG + Intergenic
1049641330 8:143717346-143717368 AGGGCCAATGGGATTGGGGGTGG + Intronic
1049803131 8:144527317-144527339 GGGGCCAAGGGAAAGGCGGGAGG - Exonic
1050036344 9:1439781-1439803 AGGGCCAAGGGGATATGAGGAGG + Intergenic
1052770182 9:32680750-32680772 AGTGCCATGGGGACTGGGGCAGG - Intergenic
1053122779 9:35558937-35558959 AGGGCCAAAGGGAATGGCCTGGG - Intronic
1053142425 9:35690097-35690119 AGGGAAGAGGGGGATGGGGGCGG - Exonic
1054885314 9:70191480-70191502 AGGACCAGAGGGGATGGGGGTGG - Intronic
1055757177 9:79570460-79570482 AGGGGCCTGGGAAATGGGGGCGG - Intergenic
1056999137 9:91491620-91491642 AGGACCACTGGGAATTGGGGCGG - Intergenic
1056999642 9:91495725-91495747 AGGGAGAAGGGGACTGGAGGGGG + Intergenic
1057042161 9:91855708-91855730 ATGGATGAGGGGAATGGGGGTGG + Intronic
1057334015 9:94142023-94142045 AGGGACAAGGGCAAAGGTGGTGG - Intergenic
1057399737 9:94712445-94712467 GGGGCCTAGGGGAATATGGGTGG + Intergenic
1058049448 9:100392195-100392217 AGGGGGAAGGGGGATGGGGAGGG - Intergenic
1058578247 9:106426186-106426208 AAGGACAAGGTGAAGGGGGGTGG + Intergenic
1059375121 9:113875863-113875885 AGGGGCTGGGGGACTGGGGGAGG + Intergenic
1060773303 9:126348294-126348316 AGGACAAAGGGGAATGTGGAGGG - Intronic
1060861479 9:126958195-126958217 AATTTCAAGGGGAATGGGGGAGG + Intronic
1060964756 9:127706357-127706379 ATAGCCAAGGGGAATGGCAGTGG - Intronic
1061035756 9:128113595-128113617 ATGGCCAGGGGGAATGAAGGAGG + Intergenic
1061042145 9:128146401-128146423 GGGGCCCAGTGGAAAGGGGGTGG + Intergenic
1061043871 9:128153998-128154020 AGGGCCAGGGGGAAGTGAGGAGG + Intergenic
1061393421 9:130330351-130330373 CTGGACAAGGGGAATGGAGGGGG - Intronic
1061882230 9:133574174-133574196 AGAGGGAAGGGGAATGGGGGAGG + Intronic
1062004063 9:134230527-134230549 AGGGCCAGGGGGACTCGAGGAGG + Intergenic
1062158983 9:135069456-135069478 AGGGCCAAGGGGCAGGGGAGAGG + Intergenic
1062158995 9:135069489-135069511 AGGGCCAAGGGGCAGGGGAGAGG + Intergenic
1062159007 9:135069522-135069544 AGGGCCAAGGGGCAGGGGAGAGG + Intergenic
1062159019 9:135069555-135069577 AGGGCCAAGGGGCAGGGGAGAGG + Intergenic
1062321648 9:135993193-135993215 AGGGCAGTGGGGAAAGGGGGCGG - Intergenic
1062532228 9:137007018-137007040 AAGGCTAAGGGGAAGGGGGCCGG + Intergenic
1062588733 9:137263503-137263525 AGGGCCAGGGGGAAGGAGGGAGG - Intronic
1062745450 9:138208959-138208981 GGGGCCATGGGGATTGGGTGGGG - Intergenic
1203740786 Un_GL000216v2:175529-175551 GGGGCGAAGGGGAAAGGGTGAGG - Intergenic
1203363548 Un_KI270442v1:238053-238075 AGGGACAAGGGGAAGAGGGAAGG + Intergenic
1186293241 X:8121873-8121895 ATGGCTGAGGGGGATGGGGGAGG - Intergenic
1186324366 X:8462609-8462631 GGGGTGAAGGGGAAGGGGGGGGG + Intergenic
1186391536 X:9164649-9164671 AGGGGCAAGGGGAGTGGGGGCGG + Intergenic
1186523639 X:10228233-10228255 AAAACTAAGGGGAATGGGGGAGG - Intronic
1187023256 X:15406618-15406640 AGGGCCCAGGGGTGTGGGTGGGG + Intronic
1187299376 X:18032896-18032918 AGGGAGAAGGGGAATAGGTGAGG + Intergenic
1187309063 X:18123127-18123149 AAGGAGAAGGGGAGTGGGGGAGG - Intergenic
1187323004 X:18257935-18257957 AGGGGAAAGGGGAAGGGGAGAGG + Intronic
1187765950 X:22642311-22642333 AGGAACAATGGGGATGGGGGTGG - Intergenic
1189120065 X:38385032-38385054 AGGGGCTGGGGGAATGGGGGTGG + Intronic
1189223357 X:39391817-39391839 AATGCTAAGGGGAATGTGGGTGG + Intergenic
1189274845 X:39778247-39778269 AGTGCCAAGGGGATAGGGGTGGG - Intergenic
1189376056 X:40467080-40467102 AGAGCCAAAGGGAATAGGGGAGG + Intergenic
1190129053 X:47730288-47730310 ATGGCCTAGGGGAGAGGGGGAGG + Intergenic
1191078997 X:56488463-56488485 AGGGTTCAGGGGAGTGGGGGTGG + Intergenic
1191661301 X:63654290-63654312 AGAGCCAATGGGAATGGCAGGGG + Intronic
1192165256 X:68823913-68823935 AGGGCCAGTGGGCCTGGGGGAGG - Intergenic
1192190657 X:68989448-68989470 AGGGCCTGGGGGTAAGGGGGAGG + Intergenic
1194534684 X:95091687-95091709 GGGGTTAAGGGGAATGGGGAAGG + Intergenic
1195026494 X:100882821-100882843 ATGGCAAAGGGGAATGAAGGTGG + Intergenic
1195260515 X:103126967-103126989 AGGACCAATGGGAAGGGAGGAGG + Intergenic
1195696223 X:107669596-107669618 AGGGGGAAGGGGGATGGGGGAGG - Intergenic
1196009902 X:110875596-110875618 AGGGCCCAGCGGAAAGGTGGAGG + Intergenic
1196098321 X:111823268-111823290 AGGCCCAGGCAGAATGGGGGAGG + Intronic
1196185384 X:112739835-112739857 GGGGAAAAGGGGTATGGGGGAGG + Intergenic
1196283492 X:113852377-113852399 AGGGCCAGGGGAAGTGGGGATGG - Intergenic
1196584951 X:117418831-117418853 AGAGACATGGGGAAGGGGGGTGG - Intergenic
1198036406 X:132805432-132805454 TGCCCCAAGGGGGATGGGGGAGG - Intronic
1199399345 X:147378196-147378218 AGGGCCAATGGGAATGAGTAGGG - Intergenic
1200049848 X:153422971-153422993 AGGGCTAAGGGGAAGAGGGGTGG - Intergenic