ID: 1173688481

View in Genome Browser
Species Human (GRCh38)
Location 20:44940644-44940666
Sequence CTGGGGAAACCCTCTGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173688481 Original CRISPR CTGGGGAAACCCTCTGATTT TGG (reversed) Intronic
903240829 1:21981471-21981493 ATGGAGAAACCCTCGGCTTTGGG - Intronic
903244566 1:22006111-22006133 ATGGAGAAACCCTCGGATATGGG - Intronic
906786957 1:48624515-48624537 CTGGGTAAACCCCCTGGTTAAGG - Intronic
907953315 1:59204855-59204877 CTGGGAAGACACTCTCATTTTGG - Intergenic
912106372 1:106281859-106281881 CTGTAGAAGCCCTCTAATTTTGG + Intergenic
914854501 1:151341432-151341454 TTGGGGAATCCATGTGATTTTGG + Exonic
918481809 1:184986173-184986195 CTAGGGAAACCCTGTGGTTAGGG + Intergenic
920034799 1:203058957-203058979 CTGGGGAGACTCTCTGAACTGGG + Intronic
920393725 1:205628678-205628700 CTGGGGAACACCTGTTATTTTGG - Intronic
1064569422 10:16676828-16676850 CTAGATACACCCTCTGATTTTGG - Intronic
1065552783 10:26886424-26886446 CTGGGAAAACCCTTTCATCTTGG - Intergenic
1065709532 10:28502131-28502153 ATGGGTAAACCCTCAGATATGGG - Intergenic
1067760573 10:49042537-49042559 CTGGTGAAAACCTTAGATTTTGG + Intronic
1067804571 10:49384078-49384100 CTGGGGGCACCCTCAGATTCGGG - Intronic
1068840419 10:61607552-61607574 CTTGGAATACCTTCTGATTTTGG - Intergenic
1072155909 10:92723456-92723478 CTTGGGAATCCCTTTGGTTTAGG + Intergenic
1074675733 10:115848524-115848546 CCAGGGAAACCCTCTGTCTTAGG + Intronic
1075796967 10:125127547-125127569 CTAGGGATACCCTTTGATTTAGG - Intronic
1076395426 10:130135184-130135206 CTTGGGAATCCCCCTGATGTTGG - Intergenic
1077007844 11:367325-367347 CAGGGGACACCCTCTGACTGTGG + Intergenic
1079214644 11:18497706-18497728 CTGGTGAAGCTCTCTTATTTTGG - Intronic
1081686738 11:45048336-45048358 CCTGTGAAACCCTCTGGTTTTGG + Intergenic
1081878215 11:46425519-46425541 CTGGAGAAACTCACTGATATCGG + Intronic
1082294508 11:50422678-50422700 CTTGGGCAACCCTGTGGTTTAGG - Intergenic
1087132102 11:94677470-94677492 CTGGGGAAACCCCCTAAGTTAGG - Intergenic
1089021792 11:115223228-115223250 CTGGGCTGAACCTCTGATTTGGG - Intronic
1090603069 11:128392528-128392550 CTGGGGAAACCCACAGAGTGTGG - Intergenic
1093225884 12:16482784-16482806 CTGGGTAAGGTCTCTGATTTCGG - Intronic
1096772920 12:53947822-53947844 CAGGGGAAACCCAGGGATTTTGG - Intergenic
1096913423 12:55007218-55007240 ATGGTGAAACCCTGTGATATGGG + Intergenic
1097371443 12:58786375-58786397 CTGGTGAAGCCTTCTGATTCTGG - Intronic
1099618463 12:84970780-84970802 TTGGGGTAACCCTCTGAATCTGG + Intergenic
1100406753 12:94278623-94278645 CTGGGGAAACCATCTGACTGAGG + Intronic
1100764250 12:97846046-97846068 CTGGGGACCCCCTCTGAGTATGG + Intergenic
1101060829 12:100970270-100970292 CTGGGAAACCACTTTGATTTAGG - Intronic
1103146837 12:118602339-118602361 CTGGGGAAACCAACTGAATGAGG - Intergenic
1103924042 12:124413950-124413972 GTGGAGACACCCTCTGATATGGG - Intronic
1107401158 13:40070565-40070587 CTGGAGCAACCCTGTGATGTAGG - Intergenic
1108392164 13:49957104-49957126 CTGGGTAAACCCTGTGTTTGTGG - Intergenic
1110732787 13:78899203-78899225 CTAGGGAAACCATCTAATCTTGG - Intergenic
1110836887 13:80093641-80093663 CTGGGGAAACCCACTTGTCTGGG + Intergenic
1113040593 13:106100503-106100525 CTGGGGACACCCTCAGCTTCTGG - Intergenic
1113315002 13:109169738-109169760 GTGGAGAAACCATCTGATTCTGG - Intronic
1113577502 13:111404595-111404617 CTGAGGAACCCCTTTGATGTTGG + Intergenic
1113662158 13:112114974-112114996 CTGGGGAAACCCTGCGTGTTTGG + Intergenic
1113920750 13:113908014-113908036 CTGGAGAAGCCCCCTGTTTTTGG + Intergenic
1114332423 14:21650877-21650899 CTGGCTAAATCCTCTGTTTTAGG - Intergenic
1121589224 14:95088312-95088334 CTGTGAAAACAATCTGATTTTGG + Exonic
1122330551 14:100909542-100909564 CTGGGGATTCCCTCTGCTTCTGG + Intergenic
1124697126 15:31872997-31873019 CTGGTGAAACCATCTGAATCTGG + Intergenic
1124931189 15:34121299-34121321 CTGGGGAAACTTTCGGATATTGG - Intergenic
1125229816 15:37440932-37440954 CTTGGGATAATCTCTGATTTAGG + Intergenic
1128335963 15:66785962-66785984 CTGGGGCATCCCTTGGATTTGGG - Intergenic
1134412645 16:14015823-14015845 CTGGGAAAGCCCACTGATTTTGG - Intergenic
1135067877 16:19326092-19326114 CTGGGCAAATCCTCTGGATTTGG - Intergenic
1137723473 16:50641464-50641486 TAGGTGAAACCCTCAGATTTTGG - Intergenic
1138351890 16:56350475-56350497 CTGGGCAAAAACTCTGCTTTGGG - Intronic
1138482354 16:57311953-57311975 CGGGGGAAACACTCTGAATTGGG - Intergenic
1141412831 16:83847029-83847051 CTGGGGAAGCCCTCTGCTCATGG - Intergenic
1141443778 16:84045401-84045423 ATGGGGAAAACCTCTTAATTCGG + Intergenic
1143140766 17:4740682-4740704 CTGGGGTAGCCTTCTGATCTGGG - Exonic
1143910377 17:10244070-10244092 CTGGTGACATCCTCTGCTTTTGG + Intergenic
1147554062 17:41465133-41465155 GAGGGGAAGCCCTCTGCTTTGGG - Intronic
1156139707 18:34091722-34091744 GTGGGGAAAACCTCTGATGCAGG + Intronic
1156852686 18:41746319-41746341 ATCTGGAAACCCACTGATTTAGG - Intergenic
1158854647 18:61530879-61530901 CTGAGGACATCCTCTGAATTTGG - Intronic
1164520425 19:28975002-28975024 CTGGAGAAAGCCTAAGATTTGGG + Intergenic
1165067659 19:33238492-33238514 CTGGGGCCACCCTGTGATCTTGG + Intergenic
925962061 2:9027014-9027036 CTGGGGAAACCCTTTGGTTTAGG + Intergenic
926711519 2:15885908-15885930 CTGGGCACATCATCTGATTTTGG - Intergenic
927057296 2:19377633-19377655 TTGGTGAAAACCTCTGAATTAGG + Intergenic
939503223 2:143012097-143012119 TTGGGGACACCCTCCGCTTTGGG - Intronic
941542343 2:166802342-166802364 CAGTGGAAACCATCTGAGTTGGG - Intergenic
942831860 2:180246314-180246336 CTTGGGAAACCCCATGATGTGGG - Intergenic
944385163 2:199155405-199155427 CTGGGGAAACCCACTTGTCTGGG - Intergenic
1169359625 20:4937139-4937161 GTGGATAAACCCTCTGATCTCGG - Intronic
1170496648 20:16931230-16931252 GTGGGGAAACCCACTCATCTTGG - Intergenic
1170964588 20:21054984-21055006 CTGTGGCAACCCTATGAGTTAGG - Intergenic
1172480307 20:35267489-35267511 CTGGGGAAGGCTCCTGATTTGGG + Intronic
1173077661 20:39834990-39835012 TTGGGGAAACCCCCTATTTTAGG - Intergenic
1173688481 20:44940644-44940666 CTGGGGAAACCCTCTGATTTTGG - Intronic
1174107557 20:48173439-48173461 CTGGGGAACCCCTCAGTCTTAGG + Intergenic
1178465478 21:32843649-32843671 CTGGTCAAGCCCTCTTATTTTGG + Intergenic
1179062738 21:37994846-37994868 CTGAGGAAACCCTGTGAGTACGG + Intronic
1181558864 22:23688218-23688240 CTCGGGAAAGACTCTCATTTTGG - Intronic
1182480930 22:30608238-30608260 CTGGGGAAACCCTGAGAGGTGGG + Intronic
1185245319 22:49770108-49770130 CCGGGGAGTCCCTCTGGTTTGGG - Intergenic
1185409043 22:50673245-50673267 CTGGGGAACCCCTCTGCCTAAGG - Intergenic
951852661 3:27159938-27159960 CTGGGGAAATGCTCTGATTTTGG + Intronic
953442315 3:42928932-42928954 CAGGGGAAAGGCTCTGGTTTCGG - Intronic
955621267 3:60866686-60866708 CTGGAAAAACCCTCTGGGTTAGG - Intronic
957584287 3:82114427-82114449 CTGGGGAAACCCACTCATCTGGG + Intergenic
958481904 3:94654018-94654040 GGGGGGAAACCCACTCATTTAGG + Intergenic
958759838 3:98293725-98293747 CTTGGGAAACCCCCCCATTTTGG + Intergenic
959031045 3:101299949-101299971 GTGGGGAAACCCACTCATCTGGG + Intronic
959493235 3:107018203-107018225 CTGGGGAAGCCAACTGATCTTGG + Intergenic
960394799 3:117123411-117123433 ATGGGGAAGGCCTTTGATTTTGG - Intronic
964339191 3:155690454-155690476 CTAGGGGAGCCCTCTGATTAAGG - Intronic
965889439 3:173492843-173492865 CTAGAGAAACCCTATGCTTTAGG + Intronic
969215976 4:5722866-5722888 CTGGGGAGACTCTCAGAATTTGG + Intronic
975551818 4:75620802-75620824 CTGGTGAAATCCTTTCATTTGGG + Intronic
975726130 4:77293449-77293471 TTGGGAAAAGCCTATGATTTGGG + Intronic
976433260 4:84987943-84987965 CTGGGGAATGCCTCTCAGTTAGG - Intergenic
977353026 4:95912271-95912293 CTGGGGAAACAATCTAATTTTGG - Intergenic
979741518 4:124156853-124156875 CTGTTGAGACACTCTGATTTAGG + Intergenic
984356839 4:178671073-178671095 CTGTGGAAATACTCTCATTTTGG + Intergenic
987299276 5:16582623-16582645 CAGGGGAAACCCTCTGCTCATGG + Intronic
992025518 5:72665430-72665452 ATGGAGAAAACCTTTGATTTGGG - Intergenic
993176793 5:84496814-84496836 CTGGGGAAACCTTCTGTGTTAGG - Intergenic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
997096988 5:130924147-130924169 TTGGGGTAACCCACTCATTTGGG - Intergenic
997762707 5:136464719-136464741 CTGGGGAAACCATAGCATTTGGG - Intergenic
999368440 5:151038193-151038215 CTGGGGAAACCCTTTCTTTTTGG - Intronic
1002071923 5:176683975-176683997 CAGGGAAAACCCTCTGATTCTGG + Intergenic
1002574881 5:180168849-180168871 CAGGAGAAACCCTCTGCTTCTGG - Intronic
1002704397 5:181150500-181150522 AAGGGGAAATCCTCTGCTTTCGG + Intergenic
1006866555 6:37213508-37213530 CTGGCCAAACCCTGTGACTTGGG - Intronic
1007125622 6:39423307-39423329 CTGGGGAAATGCTCTGTTATTGG + Intronic
1015499982 6:133921655-133921677 CTAGAGAAACCCTGGGATTTAGG - Intergenic
1016719800 6:147282852-147282874 CTTAGGAAACCATCTGATTCTGG - Intronic
1017545043 6:155441603-155441625 CTCAGGAAACCCTCTAATTTAGG - Intronic
1020670104 7:11096097-11096119 CTGGGAAAACCATGTGATTAAGG - Intronic
1020739781 7:12000122-12000144 TAGGGGAAACCGTCTGAGTTGGG - Intergenic
1021505057 7:21373496-21373518 CTAGGTAAACTGTCTGATTTGGG + Intergenic
1027419030 7:78002229-78002251 CTGGGGATACCCTCTGTGTTAGG + Intergenic
1028442561 7:90880531-90880553 GTGGGGAAACCCACTCATCTGGG - Intronic
1029977799 7:104850547-104850569 CTGGGGAAGCCCTCTGCATCAGG - Intronic
1030701516 7:112646645-112646667 CAGGGGAAACCCACTCATCTAGG + Intergenic
1030857469 7:114579076-114579098 CCTGGGAAACCCTCAGATTTTGG - Intronic
1034561931 7:151885906-151885928 CTGGGGAAACAGTTTGCTTTTGG + Intergenic
1034926748 7:155128950-155128972 CTGGGGAAATCCTTTGTTTCTGG + Intergenic
1037516047 8:19633184-19633206 CTGGGGAAGCCCTCTTAATTCGG - Intronic
1037589542 8:20301719-20301741 CTGGGGAAAGCCAATGCTTTGGG - Intronic
1039224723 8:35376175-35376197 TTGGGGGAACCCTTTGATTTGGG + Intronic
1039355160 8:36807324-36807346 CTGGAGTGACCCTCTGATTTTGG + Intronic
1040059378 8:43091598-43091620 CGGGAGAAACCCTCTGATTCTGG - Intergenic
1041129062 8:54677177-54677199 CTGGGAAAACCCTCTGTCCTGGG + Intergenic
1041401063 8:57445884-57445906 CTGGGGAAATCCCCTGTTTTAGG - Intergenic
1042576697 8:70228362-70228384 CTGGGGGGACCCTCTAGTTTTGG + Intronic
1045319623 8:101072057-101072079 CTGGGGAAAGCCTGCGTTTTGGG + Intergenic
1047716719 8:127602560-127602582 CTAGGGAAACCATCTGGTCTTGG - Intergenic
1052394610 9:27923779-27923801 GTGGGTAAATCTTCTGATTTGGG + Intergenic
1052725313 9:32221815-32221837 ATGGGGAAACTTTCTGATTTTGG + Intergenic
1055872683 9:80902670-80902692 CTGGGCAAACCTCCTGATTACGG - Intergenic
1057198812 9:93129734-93129756 CTGGGGCAGCCCTATGCTTTGGG - Intronic
1057459013 9:95242551-95242573 CTGGGGAAACTCCCAGTTTTGGG - Intronic
1061562646 9:131416002-131416024 CTGGGTTAATCCTTTGATTTTGG + Intronic
1061670970 9:132188057-132188079 CGGGGGAAACCCTATGGCTTGGG - Intronic
1062440089 9:136565933-136565955 ATGGGGAAAGTCTCTGAGTTGGG - Intergenic
1186492247 X:9983219-9983241 GTGGAGAAACCATCTCATTTTGG - Intergenic
1187058301 X:15761870-15761892 CTGTTGAAAACCACTGATTTAGG + Intronic
1188164514 X:26845524-26845546 CTGGAGAATCTCTGTGATTTAGG + Intergenic
1196759606 X:119189743-119189765 CTGGGGAGAAGCTCTGAGTTGGG - Intergenic
1199077004 X:143535884-143535906 CTGGGGAAAGCCTATGACTTGGG + Intergenic