ID: 1173688571

View in Genome Browser
Species Human (GRCh38)
Location 20:44941378-44941400
Sequence CCTTTTATTGCCTCATAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173688571_1173688579 22 Left 1173688571 20:44941378-44941400 CCTGCTTATGAGGCAATAAAAGG 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1173688579 20:44941423-44941445 CTGTCCCTTGACTGTGCCGATGG 0: 1
1: 0
2: 1
3: 8
4: 121
1173688571_1173688580 23 Left 1173688571 20:44941378-44941400 CCTGCTTATGAGGCAATAAAAGG 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1173688580 20:44941424-44941446 TGTCCCTTGACTGTGCCGATGGG 0: 1
1: 0
2: 0
3: 5
4: 53
1173688571_1173688581 24 Left 1173688571 20:44941378-44941400 CCTGCTTATGAGGCAATAAAAGG 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1173688581 20:44941425-44941447 GTCCCTTGACTGTGCCGATGGGG 0: 1
1: 0
2: 0
3: 4
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173688571 Original CRISPR CCTTTTATTGCCTCATAAGC AGG (reversed) Intronic
902393164 1:16117964-16117986 CCTACTACTGCCCCATAAGCTGG - Intergenic
905047632 1:35020009-35020031 GCTCTTATTGCCTCATTAACTGG - Intronic
908294242 1:62697555-62697577 CCTTTTCTTCCCTCCCAAGCAGG - Intergenic
911062506 1:93760344-93760366 ACCTTTATCGCCTTATAAGCTGG - Intronic
918502692 1:185216031-185216053 CCTTTGATTACTTCATAGGCAGG - Intronic
922652770 1:227355467-227355489 CCCTTCATTGCCTCAAGAGCTGG - Intergenic
923836054 1:237612029-237612051 TTGTTTATTGACTCATAAGCTGG - Intronic
1065778492 10:29144508-29144530 CCTTCTACTGTCTCATGAGCTGG + Intergenic
1069543818 10:69315353-69315375 GCCTTTATTGTCTTATAAGCAGG + Intronic
1071307632 10:84313159-84313181 CCTTTTATTTTTTCAAAAGCTGG + Intergenic
1073967255 10:109004754-109004776 CATTTTATTCTCTCATAACCAGG + Intergenic
1075098787 10:119491119-119491141 CCTTTTATGTCCTCACATGCTGG - Intergenic
1077092802 11:787364-787386 CCTGTTATTGCATTATACGCTGG + Exonic
1079780941 11:24603808-24603830 TCTTTTACTGCCTCACAAGAAGG - Intronic
1081125357 11:39314305-39314327 CTTTGGATTGCCTCATAAGGAGG + Intergenic
1087377995 11:97368099-97368121 CTTTTTTGTGCCTCATAAACAGG - Intergenic
1087738643 11:101862531-101862553 CCTGTGATTGCATCACAAGCTGG - Intronic
1089036957 11:115404484-115404506 CCTTTTATGACCTCAGAAGTAGG + Intronic
1089865635 11:121628870-121628892 TCCTTTCTTGCCTAATAAGCCGG + Intronic
1095464168 12:42473297-42473319 TGTTTAATTGCATCATAAGCAGG + Intronic
1095698760 12:45169613-45169635 CAGTTTATAGCCTCAGAAGCAGG - Intergenic
1096741915 12:53699714-53699736 CCTTTTATTGCATCAGTACCGGG - Intergenic
1098835567 12:75420670-75420692 CCTATTATTTCCTCCTAATCTGG + Intronic
1102898592 12:116618430-116618452 CCTGCTATTGTCTCATAGGCTGG - Intergenic
1104652744 12:130548441-130548463 CATTTTGTAGCCTGATAAGCTGG - Intronic
1105956305 13:25286867-25286889 CCTTTCGTTGCCTCATCAACCGG - Intronic
1110618229 13:77565404-77565426 CATTTTATACCCTCAAAAGCAGG + Intronic
1114239694 14:20855125-20855147 CTTTTTAAAGCCTCATAAGGTGG + Intergenic
1116483662 14:45420704-45420726 GTTTTTATGGCCTAATAAGCAGG - Intergenic
1116558305 14:46342182-46342204 CCTTTCAATGCCTCAGAGGCAGG - Intergenic
1118733421 14:68685227-68685249 CTTTTCATTTCCTGATAAGCTGG - Intronic
1120027258 14:79600534-79600556 CTTTCTATTGCCTCTTAACCAGG - Intronic
1121168441 14:91832638-91832660 CAGTTTATAGCCTCACAAGCGGG - Intronic
1125283624 15:38069818-38069840 CCTTTTATTGCCCCAAACACAGG + Intergenic
1126469346 15:48990995-48991017 TCATTTATTGTCTCCTAAGCAGG + Exonic
1133493763 16:6296906-6296928 CCTTTAATTTCCTAATAAACAGG - Intronic
1135552107 16:23406385-23406407 CCTTTCGTTGCCTTATAAACTGG - Intronic
1138220253 16:55244282-55244304 CCTTTTATTGCATTATAATCAGG + Intergenic
1145184719 17:20784396-20784418 CCTTTTATTGGCTGCCAAGCAGG - Intergenic
1146382732 17:32342931-32342953 CCTTTTATAGCATCATAAAATGG - Intronic
1149063375 17:52451380-52451402 CTTTTGATCTCCTCATAAGCAGG - Intergenic
1149688007 17:58549454-58549476 CTTTTTATTGCATCATAACATGG + Intergenic
1151337729 17:73449989-73450011 CCTCCTATTGCCTCATTAGCTGG - Intronic
1203171838 17_GL000205v2_random:155548-155570 CCTCTCAGTGCCTCAGAAGCCGG + Intergenic
1203173895 17_GL000205v2_random:177209-177231 CCTCTCAGTGCCTCAGAAGCAGG - Intergenic
1154486714 18:14877757-14877779 ACCTTTAGTGCCTCATTAGCAGG - Intergenic
1155405659 18:25484070-25484092 CCCTTTTTTGTTTCATAAGCAGG + Intergenic
1155460023 18:26068356-26068378 GCTTTTATTGCATAAAAAGCAGG + Intronic
1157588471 18:48820301-48820323 CCATTTGCTGCCTCATAACCAGG + Intronic
1159355640 18:67335153-67335175 CCTTTTAAGGCCTCATAAGAGGG - Intergenic
1162717787 19:12644727-12644749 CCTTTTCAGGCCTCACAAGCTGG + Intronic
926213692 2:10890481-10890503 CCTTTACTTGGCTCAAAAGCCGG + Intergenic
939859221 2:147397614-147397636 CCTTTTATTTCCTCTCAAGAGGG - Intergenic
1169356150 20:4907385-4907407 TCTTTTATTGCCTCCTATCCTGG + Intronic
1173688571 20:44941378-44941400 CCTTTTATTGCCTCATAAGCAGG - Intronic
1174878904 20:54255570-54255592 CTTTTTCTTGTCTCAAAAGCTGG + Intergenic
1175775660 20:61651932-61651954 CTTTCTATTGCCTCAGTAGCAGG - Intronic
1176329887 21:5538855-5538877 CCTCTCAGTGCCTCAGAAGCAGG - Intergenic
1176397870 21:6282096-6282118 CCTCTCAGTGCCTCAGAAGCAGG + Intergenic
1176439287 21:6707008-6707030 CCTCTCAGTGCCTCAGAAGCAGG - Intergenic
1176463549 21:7034077-7034099 CCTCTCAGTGCCTCAGAAGCAGG - Intergenic
1176487110 21:7415856-7415878 CCTCTCAGTGCCTCAGAAGCAGG - Intergenic
1176794588 21:13361642-13361664 ACCTTTAGTGCCTCATTAGCAGG + Intergenic
1177961620 21:27673861-27673883 GCTTTTATTTTCTCAAAAGCTGG - Intergenic
1183179719 22:36251994-36252016 TCTCTTCCTGCCTCATAAGCTGG + Intergenic
956534649 3:70262079-70262101 CCTTTTCTTTTCTCAAAAGCTGG + Intergenic
963233660 3:142934866-142934888 CCTGATGTTGCCTCAGAAGCAGG - Intergenic
969605852 4:8201939-8201961 CCTTTTTGTCCCTCAGAAGCTGG - Intronic
970045382 4:11847033-11847055 TCTTTCATTTCCTCTTAAGCAGG - Intergenic
970578136 4:17447618-17447640 TCTGTTACTGCCTCATAATCTGG - Intergenic
974241681 4:59257366-59257388 CATTTTATTACCTGACAAGCAGG + Intergenic
975733170 4:77357150-77357172 CCTTTGCTTGCCTCATATGAAGG + Intronic
978274388 4:106932001-106932023 CCTTTTTTTGCCACATAAAATGG + Intronic
981008903 4:139904184-139904206 CAATTTATTCCCTCATAAGGAGG - Intronic
981230498 4:142348593-142348615 TCTTTTATTTCCTTATAGGCTGG - Intronic
982403952 4:155000057-155000079 CCTTTAATTGCATCAAATGCGGG - Intergenic
987142412 5:14959776-14959798 CCTTGCTTTGCCTCATAAACAGG + Intergenic
987835563 5:23156505-23156527 CCTTCTATTGCCTCATATGTGGG + Intergenic
988410430 5:30878748-30878770 CCTATTCTGGCCTCAAAAGCTGG + Intergenic
988984891 5:36608074-36608096 CCTTTTATAGCCTCATTGGAAGG + Intronic
989241131 5:39204085-39204107 CCTTTCATTGCCCCATACCCAGG + Intronic
989626634 5:43435844-43435866 CATTTTACTGCTTCATAATCTGG + Intergenic
998874195 5:146582890-146582912 CATTTTAGTGCCTCATAGCCTGG + Intronic
999841440 5:155432118-155432140 GCTTTTATTCCCTCATAACTAGG + Intergenic
1006491967 6:34395335-34395357 CCTTTTCTTGCATCTTAAGGTGG - Intronic
1017965279 6:159258877-159258899 CCCTGTATTGACTCAGAAGCTGG - Intronic
1018578068 6:165280544-165280566 GCTTTTTCTGCCCCATAAGCTGG + Intronic
1025872733 7:65449871-65449893 CCTGTTATTGCCTCAGGAGTTGG + Intergenic
1028763162 7:94518075-94518097 CATTATATTGCTTTATAAGCAGG - Intronic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1033576324 7:142688826-142688848 CCTTTTCTTTTCTCAAAAGCTGG - Intergenic
1033577014 7:142695191-142695213 CCTTTTCTTTTCTCAAAAGCTGG - Intergenic
1034366469 7:150553254-150553276 CCTGTTATTGTGTCATTAGCTGG - Intergenic
1035981165 8:4374116-4374138 CATTTTATTGACCCATCAGCTGG + Intronic
1036391903 8:8330890-8330912 CCTTTGAGAGCCTCATAAGTAGG - Intronic
1046404372 8:113753816-113753838 AGTTTTATTGACTCATAAGGTGG + Intergenic
1048010849 8:130454837-130454859 CCTTTTATTGCCTCAGGTTCAGG + Intergenic
1049949803 9:633106-633128 ACTTTTAGTGCCCCATAAGAAGG + Intronic
1052890504 9:33695073-33695095 CCTTTTCTTTTCTCAAAAGCTGG - Intergenic
1053082608 9:35190040-35190062 CCTTTTAGGGCCTAAGAAGCAGG + Intronic
1053887646 9:42656534-42656556 ACCTTTAGTGCCTCATTAGCAGG - Intergenic
1054226668 9:62463984-62464006 ACCTTTAGTGCCTCATTAGCAGG - Intergenic
1057166775 9:92934082-92934104 CCTTTCATTGCCTCATACATTGG - Intergenic
1059402659 9:114080184-114080206 CCTTTGATTCTCACATAAGCAGG - Intergenic
1060452296 9:123754390-123754412 CCCTTTATTTCCACACAAGCTGG + Intronic
1061729642 9:132603876-132603898 CCTCTAATCGCCTCATTAGCAGG + Intronic
1203432208 Un_GL000195v1:101471-101493 CCTCTCAGTGCCTCAGAAGCAGG + Intergenic
1187729368 X:22237276-22237298 CCCTTGATTTCCTCAGAAGCTGG - Intronic
1187840294 X:23479914-23479936 CCTTTTTGTGACTCCTAAGCAGG - Intergenic
1190035522 X:47019778-47019800 CTTTTTATTGCCTCCTTAGTTGG + Intronic
1193675332 X:84445161-84445183 GCTTTTCTAGCCTCATAAGTTGG - Intronic
1196867793 X:120085430-120085452 CCTTTTATAGCCTCATACAAGGG + Intergenic
1196875309 X:120150851-120150873 CCTTTTATAGCCTCATACAAGGG - Intergenic
1198826067 X:140699296-140699318 TCTTTGATTGCCTCAAGAGCTGG + Intergenic
1199620028 X:149691571-149691593 GCTTATAATGCCTCATAACCTGG + Intronic
1200757555 Y:7004328-7004350 TTTTTTTTTTCCTCATAAGCTGG - Intronic