ID: 1173689040

View in Genome Browser
Species Human (GRCh38)
Location 20:44945045-44945067
Sequence GTTCTGAGTGGATCACAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173689040_1173689042 0 Left 1173689040 20:44945045-44945067 CCAAACTGTGATCCACTCAGAAC 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1173689042 20:44945068-44945090 TTACTTTAAAATAAGAAGCAAGG 0: 1
1: 0
2: 1
3: 64
4: 670
1173689040_1173689044 27 Left 1173689040 20:44945045-44945067 CCAAACTGTGATCCACTCAGAAC 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1173689044 20:44945095-44945117 ATTCAAGTTTAACTCTAACCTGG 0: 1
1: 0
2: 0
3: 11
4: 103
1173689040_1173689043 4 Left 1173689040 20:44945045-44945067 CCAAACTGTGATCCACTCAGAAC 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1173689043 20:44945072-44945094 TTTAAAATAAGAAGCAAGGTAGG 0: 1
1: 0
2: 4
3: 64
4: 684

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173689040 Original CRISPR GTTCTGAGTGGATCACAGTT TGG (reversed) Intronic
903051091 1:20601774-20601796 GTTCCGTGTTGATCACATTTGGG - Intronic
905343539 1:37295675-37295697 GTTTTGACTGGATCACCGTAAGG + Intergenic
908227449 1:62070421-62070443 GTGCTGAGTGAATCAAAGTTCGG - Intronic
908984939 1:70006598-70006620 GTTCTCAGTGGATACCAGCTGGG + Intronic
911199450 1:95029967-95029989 CTTCTGAGTGGTTTATAGTTTGG - Intronic
911997816 1:104788833-104788855 GTGCTGATTGGTTCACGGTTGGG + Intergenic
916356672 1:163917405-163917427 GCTCTGAGCTGATCCCAGTTGGG + Intergenic
917135604 1:171785750-171785772 CTCCTCAGTGGGTCACAGTTGGG + Intronic
920737885 1:208551603-208551625 GTACTTAGTGGATCCCACTTGGG - Intergenic
1066678402 10:37912849-37912871 GTTCCAAGTTGATCCCAGTTGGG + Intergenic
1068121517 10:52785989-52786011 GTGCTGAGAAGTTCACAGTTTGG - Intergenic
1070803450 10:79256565-79256587 ATGCTGAGGGGATCACAGGTGGG + Intronic
1076153616 10:128185669-128185691 GTTCTGTTTGGATCTCTGTTTGG + Intergenic
1077747210 11:4919893-4919915 GTTCTGAGTGGATCAGAGACAGG - Intronic
1077875067 11:6297595-6297617 CTTCTGTGTGGATCACAGCAAGG - Intergenic
1080985538 11:37459597-37459619 ATTTTGAGTGAATCACACTTTGG + Intergenic
1081357346 11:42127613-42127635 GTTCTGAGTGTTTCATATTTTGG - Intergenic
1082635267 11:55586209-55586231 TTTCTGAGTGGCTCAAAGTCTGG - Intergenic
1089811401 11:121134801-121134823 GTGCTGCATGGAGCACAGTTTGG + Intronic
1094042823 12:26135248-26135270 GGGCTGAGTGGATCACAGGAGGG + Intronic
1096771457 12:53938563-53938585 GTGCTGATTGGATCTCAGGTAGG - Intergenic
1097948548 12:65400943-65400965 GTTCTGATTGGATTACACTGTGG + Intronic
1101827268 12:108230318-108230340 GTTCTGAGATGATCAGATTTAGG - Intronic
1103046743 12:117742051-117742073 GTTCTCAGTGCATCACAGCAGGG - Intronic
1107110337 13:36690842-36690864 GTTTTGAGAGGATCACCTTTTGG + Intronic
1108707808 13:53005958-53005980 GGTCTGAGCGGATCACAGCCAGG + Intergenic
1112149082 13:96736881-96736903 CTTCTGAATGTATTACAGTTTGG - Intronic
1113469688 13:110535602-110535624 GCTCTGAGTGCCTCACAGCTTGG + Intronic
1116500052 14:45609714-45609736 CTCCTTTGTGGATCACAGTTGGG + Intergenic
1116683222 14:48003959-48003981 ATTTTGAGTGGATTACAGGTTGG + Intergenic
1116781393 14:49241223-49241245 GATCTCAGGGGATCACAGTGGGG + Intergenic
1118141244 14:63085689-63085711 GATCCAAGTGGCTCACAGTTTGG + Intronic
1119041197 14:71276282-71276304 GTTCTCAGTGGATAACACTTAGG - Intergenic
1123967740 15:25475996-25476018 ATTCTGAGTCCAACACAGTTGGG - Intergenic
1126429139 15:48562054-48562076 GTTGTCAGTAGATCACATTTTGG + Intronic
1128403455 15:67309790-67309812 GAGCTGAGTAGATCAAAGTTTGG + Intronic
1133603208 16:7360304-7360326 GTTTTCAGTTGACCACAGTTTGG - Intronic
1134206948 16:12246271-12246293 TTTCTGGGTGGGTCACAGTTGGG + Intronic
1137486282 16:48894206-48894228 GTTCTGACTACATCACAGTGTGG + Intergenic
1139322064 16:66122810-66122832 CTTCTAAATGGATCACAGTGTGG - Intergenic
1140709017 16:77658949-77658971 TTTTTGGGTGGATCACAGATTGG + Intergenic
1142059521 16:88020436-88020458 TTGCTGTGTGGATCACAGTGTGG + Intronic
1145399061 17:22516735-22516757 GCTCTGAGTTGAGCACTGTTAGG + Intergenic
1153732720 18:8030634-8030656 GTTCTGTGTAGAGCACAGATGGG + Intronic
1155414519 18:25582378-25582400 GTTCTGAGCTGATCCCAGCTGGG + Intergenic
1159481358 18:68994741-68994763 GTTTTAATTGGCTCACAGTTCGG - Intronic
1162236629 19:9314681-9314703 GTTCTGAGTTGAGCTCATTTGGG + Intergenic
925117818 2:1395269-1395291 GTTCTGCTTGGATTACAGTGTGG - Intronic
926143140 2:10380477-10380499 GGCCTGAATGGATCACAGCTGGG - Intronic
926508848 2:13747957-13747979 GTTCTAATTTGATCACAGTGTGG - Intergenic
926939931 2:18124753-18124775 CTTCTGAGTTGCTCACACTTGGG - Intronic
927200304 2:20574142-20574164 CTTCTGAGTGCATCACAGTGAGG + Intronic
928080796 2:28310493-28310515 TTTCTCAGTGGAAAACAGTTAGG + Intronic
930024041 2:47019548-47019570 GGTCAGAGTGGATCACAAGTTGG + Intronic
934580531 2:95434322-95434344 ATTCTGAGTGGAGCAAACTTGGG - Intergenic
934598918 2:95642395-95642417 ATTCTGAGTGGAGCAAACTTGGG + Intergenic
935041919 2:99439383-99439405 TTTCTTAGTGGTACACAGTTTGG + Intronic
935168909 2:100594641-100594663 GTTCTGGCTGCATCACAGATGGG - Intergenic
937160100 2:119752404-119752426 GTTCTGAGAAGATCAAAATTTGG + Intergenic
939496260 2:142931551-142931573 TTTCTGAGTGGGTTAGAGTTTGG + Intronic
942259951 2:174149611-174149633 GTTTTGAGTGGACCTCAGTAAGG - Intronic
942488769 2:176468487-176468509 TTTCTCAGTGTCTCACAGTTTGG + Intergenic
944252006 2:197587816-197587838 GTTATGAGAACATCACAGTTTGG - Intronic
947911311 2:233802698-233802720 ACTCTGAGTGGACCACAGTGAGG - Intronic
1169572229 20:6918766-6918788 GTTGTGAGTGTGTGACAGTTTGG - Intergenic
1172648648 20:36487560-36487582 ATGCTGAGTGGGGCACAGTTTGG - Intronic
1172671747 20:36639276-36639298 GTCCTGAGTTGACCACAGTCTGG - Intronic
1173555124 20:43960514-43960536 GTTGTGACTACATCACAGTTTGG + Intronic
1173622885 20:44450014-44450036 GTGCTTAGTGGATCAGGGTTGGG + Intergenic
1173689040 20:44945045-44945067 GTTCTGAGTGGATCACAGTTTGG - Intronic
1178392081 21:32206949-32206971 GTGGTGGGTGGCTCACAGTTTGG - Intergenic
1178509685 21:33193945-33193967 ATTGTGAATGGATCACAGTGGGG - Intergenic
1179585716 21:42372931-42372953 GCTCTGAGTGGATCCCAGGCAGG + Intronic
1179983401 21:44907956-44907978 TTTCTGTGTGGATTACATTTAGG - Intronic
1182622337 22:31624989-31625011 GTTCTGAGTGGATGGCAGTGTGG - Intronic
951778996 3:26341475-26341497 GTTCTTAGTTGATACCAGTTGGG + Intergenic
956179705 3:66505653-66505675 GTTCTGAGTGGTTGGCAGTGAGG - Intergenic
958961662 3:100516430-100516452 GTTCTGATTGGTTCTCAGATGGG + Intronic
961827147 3:129605224-129605246 GAGCTGAGTGGGTCACAGGTGGG - Intronic
962030733 3:131597569-131597591 GTTATGTGATGATCACAGTTTGG - Intronic
962778221 3:138684629-138684651 GTTCTGAGAGGATAACACATGGG + Exonic
965292033 3:166894825-166894847 GTACTTACTGGATTACAGTTTGG + Intergenic
965888723 3:173482657-173482679 ATTCTGAGACGATGACAGTTGGG + Intronic
968426786 4:529032-529054 CTTCTGAGTGGAGGACAGTCAGG - Intronic
969900358 4:10343763-10343785 GCACTGAGTTGATCACAGCTAGG + Intergenic
974950792 4:68581464-68581486 TTTCTGAGTGGCTCAGAGTCTGG - Intronic
979482351 4:121234605-121234627 GATCAGACTGGATCTCAGTTTGG - Intergenic
981431857 4:144670571-144670593 GGTCTGTTTGGATCAAAGTTGGG - Intronic
985012226 4:185594979-185595001 GTTATGAGTGGATTACTGATAGG + Intronic
986381711 5:7193243-7193265 GTTCTGAGTTGCACACAGATGGG + Intergenic
986418414 5:7551269-7551291 ATTCTGAGTTCATGACAGTTAGG + Intronic
993145496 5:84088401-84088423 GTTCTGTGAGAATCACATTTTGG + Intronic
995449023 5:112280057-112280079 TTTCTGAGTGGATCTTAGTATGG - Intronic
997249883 5:132380337-132380359 GGGCTTAGTGGATCACAGTTAGG + Intronic
998189835 5:140014156-140014178 AGTCTGAGTGGATCAAATTTTGG - Intronic
1001188904 5:169607650-169607672 GTTCTGAGTGGATAAATTTTGGG + Intergenic
1001772956 5:174309493-174309515 CTCCCGAGTGGCTCACAGTTCGG + Intergenic
1002516159 5:179760547-179760569 GGGCTGAGTGGATCAGCGTTTGG + Intronic
1004319150 6:14619090-14619112 GCTCTGAGTAGAGCAGAGTTAGG + Intergenic
1005813671 6:29533736-29533758 GTGCAGTGTGGCTCACAGTTGGG - Intergenic
1005891778 6:30146319-30146341 GCTCTGCCTGGATCACAGTAGGG + Intronic
1005933049 6:30498087-30498109 GCTCTGAGTTGGACACAGTTTGG - Intergenic
1007284880 6:40740518-40740540 GTTCTGAGTTGAACCGAGTTTGG - Intergenic
1007533304 6:42562422-42562444 GTCCTGAGTGGATCAGTGTAAGG + Intergenic
1008130288 6:47713331-47713353 GTTCTGAGTTAAACAAAGTTAGG + Intronic
1008284572 6:49632018-49632040 GATATCTGTGGATCACAGTTTGG - Intronic
1010602500 6:77847903-77847925 ATTCTGAGTGAATTACAGCTTGG - Intronic
1011509636 6:88086498-88086520 GTTCTGTGTGGATCCTAATTAGG - Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1020932148 7:14411214-14411236 GTTCTGAGTGCGTCTAAGTTAGG + Intronic
1023133543 7:37027709-37027731 GTTGTGAGTGGAACACAGAGAGG + Intronic
1024435086 7:49342529-49342551 GTTATCAGTGAATCACATTTAGG + Intergenic
1026670004 7:72381980-72382002 GTTCAAAGTGGATCACAACTTGG + Intronic
1032568508 7:132973903-132973925 GTCCTCATTGGAGCACAGTTGGG - Intronic
1032795276 7:135271311-135271333 GATCTGAGTGGATAACAGCACGG - Intergenic
1034275763 7:149823169-149823191 GTGCTGAGTGGATGCCAGATGGG + Intergenic
1040825729 8:51618817-51618839 GTTCTGAGTGGTGCCCAGTCTGG + Intronic
1045416576 8:101973544-101973566 GTTCTTTGTGGATACCAGTTGGG - Intronic
1047721762 8:127646789-127646811 GTTCTGAGTGCATTTCAGGTAGG - Intergenic
1047803843 8:128338159-128338181 CTTCTAAGTGGACCACAGCTTGG + Intergenic
1050435902 9:5610576-5610598 GTTCTCAGTGAAGCACAGTCTGG + Intergenic
1058333260 9:103791507-103791529 GTTTTGATTGGCTCACAGTTTGG - Intergenic
1061091797 9:128430702-128430724 GTTCTGAGAGGATAACTATTAGG - Intronic
1185683582 X:1908837-1908859 GTTCTGGGTGGATGTCAATTTGG + Intergenic
1186381097 X:9060069-9060091 GATAGGAGTGGATCACAGGTGGG - Intronic
1186749110 X:12603180-12603202 GTTAAGACTGGATCACAGATAGG - Intronic
1190131662 X:47753892-47753914 GGTGTCAGTGGATCCCAGTTAGG - Intergenic
1190562263 X:51697147-51697169 GTACTGAGTGGATCACACCCAGG + Intergenic
1193428377 X:81369108-81369130 GATCTGAGAGGACCACATTTTGG + Intergenic
1195489753 X:105454076-105454098 GTTCTGAGCTGATCCCAGTTGGG - Intronic
1198006417 X:132498939-132498961 GTCCTGTGTGGAACACAGCTAGG + Intergenic
1198768677 X:140105322-140105344 GTTCTGAGAGAATTAAAGTTTGG + Intergenic
1201705738 Y:16934798-16934820 GCTCTGAGAGGATGACAGTTTGG + Intergenic