ID: 1173689440

View in Genome Browser
Species Human (GRCh38)
Location 20:44948692-44948714
Sequence CTGCTGGCCTGGGGCATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173689440_1173689448 19 Left 1173689440 20:44948692-44948714 CCTGAAATGCCCCAGGCCAGCAG 0: 1
1: 0
2: 3
3: 27
4: 225
Right 1173689448 20:44948734-44948756 TGCTGTACGTGGCAGATTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 88
1173689440_1173689446 8 Left 1173689440 20:44948692-44948714 CCTGAAATGCCCCAGGCCAGCAG 0: 1
1: 0
2: 3
3: 27
4: 225
Right 1173689446 20:44948723-44948745 GAGATACCTGTTGCTGTACGTGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173689440 Original CRISPR CTGCTGGCCTGGGGCATTTC AGG (reversed) Intronic
900287545 1:1908849-1908871 CTGCTGGCGAGGGGCCTCTCGGG + Intergenic
901311925 1:8276056-8276078 CTGGTGGTCTGGGGCATGCCAGG + Intergenic
902374339 1:16023236-16023258 CAGCGGGCCAGGGGCATTGCTGG + Intronic
903173756 1:21568931-21568953 CTGCGGGCCTGGGGCAGCTGGGG + Intronic
903187807 1:21639180-21639202 CTGCCAGCCTGGGGCAGCTCAGG - Intronic
905522649 1:38612318-38612340 CTTCTGGCCAGGGGCAGCTCAGG - Intergenic
906458971 1:46022906-46022928 CTGCTCAACTGGGCCATTTCTGG - Exonic
907987653 1:59548103-59548125 CTGCTGGTCTGGGGTGTTTTGGG + Intronic
908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG + Exonic
908773009 1:67613133-67613155 CTGCTGGCCTGGCGCTTTGCAGG + Intergenic
913349289 1:117840548-117840570 CTGCTGGCCTGAGGCAACTCAGG - Intergenic
915810925 1:158909830-158909852 CTGTGGGCCTGGGGCAGTGCTGG + Intergenic
918250592 1:182699753-182699775 CTGCAGGCCTGGGGCCTTCCTGG + Intergenic
920061624 1:203230747-203230769 CGGATGGCCTGTGGCATTCCTGG + Intronic
920654972 1:207868344-207868366 CGGCCGGCCTGGGGCAGTTCTGG + Intergenic
922240853 1:223754845-223754867 CGGCTGGCCTGGGGGACTCCGGG - Intronic
922613699 1:226948175-226948197 CAGCTGGGCTGGTTCATTTCTGG + Intronic
924113715 1:240725495-240725517 CAGCTGTCCTTGGTCATTTCTGG + Intergenic
1062848691 10:727056-727078 ATGCTGGCCAGGGGCAGTGCTGG + Intergenic
1067556698 10:47277985-47278007 CTCCTGGCCTGGGGGAGCTCTGG - Intergenic
1068121663 10:52786921-52786943 ATGCTGGCCTGGGGCAGGTGAGG - Intergenic
1068121676 10:52787008-52787030 ATGCTGGCCTGGGGCAGGTGAGG - Intergenic
1068187738 10:53608285-53608307 CAGTTGGCTTTGGGCATTTCAGG - Intergenic
1068863165 10:61867752-61867774 CTGCTGGCCCGGGGCAATGAGGG + Intergenic
1069995083 10:72336933-72336955 CTGCTGACCTGGGGCCTTTGGGG + Intronic
1071118563 10:82251816-82251838 CTGCAGGCCTGGGTGCTTTCTGG + Intronic
1072804374 10:98415297-98415319 CTGCTGCCCTGGGGCTGTGCTGG + Intergenic
1075072458 10:119327910-119327932 CTGCTGGCCTGAGGGATTGGGGG + Intronic
1075573457 10:123561324-123561346 CTCCTGCCCTGGGGAATTTGTGG - Intergenic
1076312725 10:129520205-129520227 TTTCTGGCCTGGCCCATTTCAGG - Intronic
1076811047 10:132886544-132886566 CTGCTGGCTTCGTGCATTTGGGG - Intronic
1079116428 11:17643331-17643353 CTCCTGCCCTGGGGCATCACGGG + Intronic
1080600492 11:33817471-33817493 CTGCTGGCCTGGTGCATCCCAGG + Intergenic
1081707094 11:45188807-45188829 CTGCTGGCACGAGGCATTTGGGG + Intronic
1084297820 11:68224591-68224613 ATGCTGTCCTGGGGGCTTTCTGG + Intergenic
1086569664 11:88267086-88267108 CTGCAGGCCTGGGGCAGTGGTGG + Intergenic
1087299270 11:96413504-96413526 CTTCTGGCCCAGGGCATGTCTGG - Intronic
1088598302 11:111455824-111455846 CTGAAGGCCTGGGGCATTCTGGG + Exonic
1089202435 11:116732456-116732478 CCGCTGGCCCGGGACAATTCTGG + Intergenic
1089388072 11:118080766-118080788 CTGCTGCCCTGGGGCGTTTCTGG - Intronic
1090844096 11:130516623-130516645 CTGGGGGCCTGGGGCACTTGAGG - Intergenic
1090852147 11:130580027-130580049 AGGCAGGCCTTGGGCATTTCTGG - Intergenic
1090936556 11:131348137-131348159 CAGCTGGCATTAGGCATTTCTGG - Intergenic
1092259299 12:6944202-6944224 CTGCTGGCCTGGGGTAGTCAAGG + Intronic
1092617159 12:10225881-10225903 CTGCTGGCCCGGGGCAATGGGGG - Intergenic
1096614898 12:52826712-52826734 CCTCTGGCCTGGGGCATCTGTGG - Intronic
1096685679 12:53286859-53286881 CTGGGGGCCTGGGGTACTTCAGG - Exonic
1096795960 12:54077731-54077753 GTGCTGCCCTGGGTCTTTTCAGG - Intergenic
1097609929 12:61807424-61807446 CTGCTGGGCTGGGGCTCTTATGG + Intronic
1099559625 12:84155374-84155396 CTGCTGGCCTGGGGCAATGAGGG - Intergenic
1101249106 12:102914875-102914897 CTGATGCCCAGAGGCATTTCTGG - Intronic
1102976940 12:117213558-117213580 CTCCTGGCCTGGGCCCTTTGGGG + Exonic
1103457800 12:121080015-121080037 CTGCAGGCCTGGGGGGTTCCGGG - Intergenic
1103735199 12:123056707-123056729 CCCCTGGCCTGGGGCATCCCGGG - Intronic
1105611469 13:21973377-21973399 GTGCTGGAATGGGGCATTGCCGG + Intergenic
1106859945 13:33894631-33894653 CTTATGGCCTGGGGCAATTTTGG + Intronic
1108609406 13:52069501-52069523 CTGAAGGCCTGGGGCATATCAGG - Intronic
1111609368 13:90583474-90583496 GTGCTGGCCTGGTTGATTTCTGG - Intergenic
1113482691 13:110633282-110633304 CTGCTGGCCCGGGGCAATGAGGG - Intronic
1113506631 13:110821267-110821289 CTGCTGGCCCGGGGCAATGAGGG + Intergenic
1113625976 13:111846768-111846790 CTGCTGTCCTGGAGTATTCCTGG + Intergenic
1114580058 14:23749116-23749138 CTGATGGCCTGGGGTCTCTCAGG + Intergenic
1117907294 14:60603638-60603660 CTGCAGACCTGGGGGATTTCTGG - Intergenic
1118242075 14:64069711-64069733 CTAGTGGCCTGGGGCATGCCAGG - Intronic
1118787006 14:69054442-69054464 CTCATGGCCTGGGCCATTGCTGG + Exonic
1118894229 14:69932353-69932375 CTGCTGCGCTGGGGCCTTCCGGG + Intronic
1119490465 14:75028165-75028187 CTGCTGGGCTGTGGCATTGGAGG - Intronic
1119546998 14:75479240-75479262 GTGCTGGACTGGGGCAGGTCTGG + Intergenic
1121025135 14:90610129-90610151 CTTCTGGTCCCGGGCATTTCGGG + Intronic
1122933314 14:104944677-104944699 CTTCTGCCTTGGGGCCTTTCAGG + Exonic
1124100407 15:26687737-26687759 CTGCTGCCCTGTAGCATATCTGG + Intronic
1126663615 15:51055802-51055824 CTGCTGGACTGGTGCCTTGCAGG + Intergenic
1127457332 15:59167086-59167108 CTGCTGACCTGAAGCATTACTGG - Intronic
1128089974 15:64912602-64912624 CAGCTGGCCTGGGGCAGCTTTGG + Intronic
1129041052 15:72686411-72686433 CTGGTCGCCTGGGGCAAGTCTGG + Intronic
1130173498 15:81543344-81543366 GTGCTTGCCTGGGGCAATGCAGG + Intergenic
1130323489 15:82859509-82859531 CTTCTGCCCTGTGGTATTTCAGG - Intronic
1130892487 15:88144980-88145002 CTTCTGGCCTGTGGCTTTCCTGG + Intronic
1131369384 15:91867070-91867092 CAGCCGGGCTGGGGCATGTCAGG + Intronic
1133298432 16:4767025-4767047 CTGCCGGCCGTGGGCAGTTCGGG + Exonic
1133650572 16:7809207-7809229 CTGCTCTACTGGGGTATTTCTGG - Intergenic
1133736548 16:8620239-8620261 GTACTGTCCTGGGGGATTTCAGG + Intergenic
1134838122 16:17379109-17379131 CTGCTGGCCTCTGACAATTCTGG - Intronic
1139973752 16:70792535-70792557 CAGCTGGCCAGTGGCATTGCAGG + Intronic
1140475705 16:75238407-75238429 CTGCTGCCCTGGGGGATGTGCGG - Intronic
1140774481 16:78237571-78237593 CTGCTGGTCTAGGTCATTCCAGG - Intronic
1141226326 16:82119548-82119570 CTGCAGGCCTGGGGTAGTGCTGG + Intergenic
1141617654 16:85219448-85219470 CTGCTGGCCTGGGGCTGGCCTGG + Intergenic
1141640174 16:85336217-85336239 CTGCTGGAGTGGCGCATGTCAGG - Intergenic
1141667972 16:85475663-85475685 CCCCTGGCCTGGGAAATTTCAGG - Intergenic
1141854182 16:86669881-86669903 CTTCTAGCCAGGGGCATTGCCGG - Intergenic
1142420446 16:89966490-89966512 CTCGTGGCCTTGGGGATTTCTGG + Exonic
1143174988 17:4950306-4950328 CTGCACGCCTGGGGCTCTTCCGG - Intronic
1144323366 17:14152903-14152925 CTGTTGGCCTGGAGCAGTGCTGG - Intronic
1144756970 17:17685762-17685784 ATGCTGTCCAGGGCCATTTCTGG + Intronic
1152489696 17:80621907-80621929 CCGCTGCCCTGGGGCTTGTCTGG - Intronic
1152963892 18:97334-97356 CTGGCGGCCGGGGGCACTTCAGG + Intergenic
1153724162 18:7937916-7937938 CTCCTGTCCTGGTCCATTTCAGG + Intronic
1154403032 18:14060475-14060497 CATCTGGTCTGGGGCTTTTCGGG + Intronic
1155493206 18:26419719-26419741 CTGCTTGCCTGGTGCAGTTCAGG - Intergenic
1160588797 18:79928179-79928201 CATCTGGGCTGGGGCCTTTCTGG - Intronic
1161377691 19:3948656-3948678 CTCTTGGCCGGGAGCATTTCAGG - Intergenic
1161664384 19:5565951-5565973 CTGCCGGCCTGGGGCAGCTCTGG - Intergenic
1162205766 19:9054930-9054952 CTGCAGGCCTGGGGCGCCTCAGG - Intergenic
1164492607 19:28728372-28728394 CTGGTGACCTGGGCCATCTCAGG - Intergenic
1165073281 19:33267787-33267809 CAGCTGGCCTGAGGCAGCTCGGG - Intergenic
1165147467 19:33740470-33740492 TTGCTGGACTGGGTCACTTCAGG + Intronic
924962572 2:46895-46917 CTGCTGGACGCAGGCATTTCCGG + Intergenic
925370583 2:3342449-3342471 CTGCTGCCCTGGTTCATTTCAGG - Intronic
926196621 2:10768045-10768067 GTGCTGGCCTGTAGCATTTGTGG + Intronic
927639055 2:24835257-24835279 CTGCTGGGCTGAGGCAGTCCTGG + Intronic
929044740 2:37778457-37778479 CTGCTGCCCTGGGGGTTTGCCGG - Intergenic
932486468 2:72086989-72087011 CTGCTGGCCCGGGGCAATGGGGG + Intergenic
933156154 2:78978055-78978077 CTGCAGGCATGTGGCTTTTCTGG - Intergenic
933685197 2:85135809-85135831 CTGCTGGCCTGGAGCACCCCAGG + Intronic
933979063 2:87535934-87535956 CTGCTGGCCTGGCCCATCTGGGG - Intergenic
934653300 2:96104387-96104409 CTGCTGGCCTGGGGCCTCGCTGG + Intergenic
934712414 2:96524799-96524821 CTGCTGCCCTCGGGCAGTTAGGG - Intergenic
935135442 2:100296485-100296507 TTGGTGGCCTGCTGCATTTCTGG + Intronic
936047051 2:109196274-109196296 CTGCTGGCCTGGAGCAGCCCAGG - Intronic
936314764 2:111414858-111414880 CTGCTGGCCTGGCCCATCTGGGG + Intergenic
938082259 2:128376481-128376503 CTCTGGGCCTGGGGCACTTCAGG + Intergenic
938661714 2:133493872-133493894 CAGCTGGCCTTGGGCCTTCCAGG - Intronic
940893149 2:159054905-159054927 CTGCTGGACTGGATAATTTCAGG - Intronic
941714410 2:168748902-168748924 CTGCTTCCCTGGGGCACTGCAGG - Intronic
941868792 2:170362015-170362037 CTGCAACCCTGGGGCATTACAGG + Intronic
942084491 2:172431097-172431119 CCGCGGGCCTGGAGCATTTCTGG - Intronic
942828153 2:180205627-180205649 GTGCTGCTCTGCGGCATTTCAGG + Intergenic
943835152 2:192508076-192508098 CTGCTGGCCCCGGGCATTGAGGG + Intergenic
945745774 2:213718599-213718621 CTGCTGGCCCGGGGCAATGGGGG + Intronic
948507701 2:238440971-238440993 GTCCTGGCCTGGGGCCTTCCAGG + Intronic
948604921 2:239128976-239128998 CTGGTGGCCTGGGAAATTCCTGG - Intronic
948631388 2:239305008-239305030 CAGCCGGCCTGGGGCATGTCAGG + Intronic
1169799496 20:9500374-9500396 CTGCTGGCCTGGGGGAAGGCTGG - Intergenic
1170219868 20:13930368-13930390 CTACTGCCCTGTGGCACTTCAGG + Intronic
1170629423 20:18055428-18055450 CAGCTGGCCTGAGGCTCTTCCGG - Intronic
1170969595 20:21104711-21104733 CTGCTAATTTGGGGCATTTCAGG + Intergenic
1171151026 20:22826661-22826683 CTGAGGGACTGTGGCATTTCAGG - Intergenic
1172649330 20:36491918-36491940 CTACAGGCCTGGGGCAATTGAGG - Intronic
1173689440 20:44948692-44948714 CTGCTGGCCTGGGGCATTTCAGG - Intronic
1174105668 20:48160867-48160889 CTGCTGGCCTGGGTCCTGTGTGG - Intergenic
1174175735 20:48643600-48643622 ATGCTGGCGAGGGTCATTTCTGG + Intronic
1174401644 20:50279057-50279079 CTGCCTGCCTGGGGCATTCCAGG + Intergenic
1175976305 20:62712065-62712087 CTGATGACCTGGGGCTTTCCAGG + Intronic
1177849878 21:26333457-26333479 CTGCTGGCCTGGGGTAGTGGTGG + Intergenic
1179016686 21:37600074-37600096 CTGGTGGCCTGTGGCCTTCCTGG + Intergenic
1179635108 21:42703717-42703739 CTGCTGGCCTTGGGCTGTGCGGG + Intronic
1180626097 22:17194442-17194464 CTGCAGGCCTGGGGGAATGCGGG - Intronic
1181043810 22:20205273-20205295 CTCCTGCCCTGGGTCATTCCAGG + Intergenic
1181759485 22:25048379-25048401 CGGCTGGCCTGGGACATGTGGGG + Intronic
1182147474 22:28005571-28005593 CTGCTGGCCTGGGTCAGTGGTGG + Intronic
1182447010 22:30395755-30395777 CTTCTGGCCTGGGGCAGGACAGG - Intronic
1183832015 22:40423312-40423334 GGGCTGGCCTTGGGCATTCCAGG - Intronic
1184690252 22:46114207-46114229 CTGCTGACCTGGGGCCTTGGTGG - Intergenic
1184799447 22:46750945-46750967 CTGCTGGCCTCGGCCATGCCTGG - Intergenic
1184891377 22:47381403-47381425 CTGGTGGCCTCGGCCATCTCAGG - Intergenic
952674306 3:36008541-36008563 CTGCTGTCCTGGGGAGCTTCTGG - Intergenic
953749084 3:45595785-45595807 CTCCTTGCCTGGGGCAGCTCAGG - Exonic
955146658 3:56326645-56326667 CTGCTGCCTTTGGCCATTTCTGG + Intronic
955241214 3:57180002-57180024 CTGCTGGCCACGGGCACTTCTGG - Intergenic
956213790 3:66827612-66827634 CTGCTGCTCTGGAGCATCTCTGG - Intergenic
956497426 3:69843364-69843386 CTGCTGGCCTAGATTATTTCTGG - Intronic
957677819 3:83393215-83393237 CTTATGGCCTGGGGCAGTTTTGG + Intergenic
958171712 3:89947407-89947429 CTTATGGCCTGGGGCAGTTTTGG + Intergenic
959991673 3:112638514-112638536 CTGCTGGCCCAGGCCGTTTCCGG - Exonic
960349988 3:116580394-116580416 CTGTTAGCATGGGGCATTTCTGG + Intronic
961378382 3:126481891-126481913 CTGCTGGCCTGGAGGAGTTCGGG - Exonic
962170298 3:133094639-133094661 CTGCTGGCCTGGCCCCTTGCAGG + Intronic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
962957296 3:140278056-140278078 CTGCGGGCCTGTGACACTTCAGG - Intronic
963933289 3:151026539-151026561 CTGCTGTCCTGGGCCATGTGTGG + Intergenic
965614947 3:170584814-170584836 CTGCGGCCCTTGGGCAATTCGGG + Intronic
967853987 3:194102629-194102651 CTGATTGCCTGGGTCATTTTAGG - Intergenic
968492831 4:899653-899675 TTGCTGTCCTGGGGCATGGCGGG - Intronic
970220676 4:13807096-13807118 CTGCTGGCTTCGGGCCTTTCTGG + Intergenic
974870814 4:67638525-67638547 TTTCTCTCCTGGGGCATTTCTGG + Intronic
975112530 4:70643342-70643364 CTTCTGGTCTGGGGTATTTATGG - Exonic
978201642 4:106029301-106029323 CTCCAGCCCTGGGGCTTTTCAGG - Intergenic
978409959 4:108415895-108415917 CTGCTGGCCTGGGGCAACTTTGG + Intergenic
980628588 4:135406727-135406749 CTGCTGGCCTCGGGCAATGAGGG + Intergenic
982842614 4:160210601-160210623 ATACTGGCCTAGGGCATTTATGG - Intergenic
983181915 4:164657749-164657771 CTGCTGAACTGGGGCATGCCAGG - Intergenic
983562676 4:169116595-169116617 CTGCTGCCGTGGGGCGTTCCTGG + Exonic
985593348 5:776457-776479 CTGCTGGCCAGGGGCCTACCCGG - Intergenic
990005340 5:50938712-50938734 CTTATGGCCTGGGGCAGGTCTGG + Intergenic
991031347 5:62085381-62085403 CTGCTGGGCTGGGGCAGGCCAGG - Intergenic
992065182 5:73100484-73100506 CTTCTGGACTGTGGCCTTTCAGG - Intergenic
995020980 5:107367185-107367207 CTGCCGGTCTCTGGCATTTCAGG - Intergenic
996288046 5:121818253-121818275 CTGCTGGTCTGGCACATTTGTGG + Intergenic
997754761 5:136386153-136386175 CTGCTGCACTGGGGCATTATTGG + Intronic
999124685 5:149238460-149238482 CTCCTCTCCTGGTGCATTTCAGG - Intronic
999701823 5:154235214-154235236 CAGCTAGTCAGGGGCATTTCTGG - Intronic
1003095637 6:3140976-3140998 CTGCTGGCCTGGGGGCTTTAGGG - Intronic
1003146273 6:3513012-3513034 CTGGTGGCCTGGGGGATAACTGG + Intergenic
1003428752 6:6019716-6019738 CTGCTGGCCTGGGGAGTTCAGGG - Intergenic
1004191740 6:13470266-13470288 CTGCTGGCATGGGGGATTCCAGG - Intronic
1006675176 6:35757538-35757560 CTGTTGGCCTGGGTCCTTCCCGG - Intergenic
1006799830 6:36752789-36752811 AGGCTGGCCTGGGTCATGTCAGG - Intronic
1007573663 6:42911141-42911163 CTGCGTGCCTGGGGCATGGCAGG - Intergenic
1010060737 6:71619966-71619988 AGTCTGGCCTGGGGCCTTTCTGG - Intergenic
1014755864 6:125301701-125301723 CCGCAGGACTGGGGCCTTTCCGG + Intronic
1015444467 6:133287381-133287403 ATCCTGGCCTGGGGAATATCAGG + Intronic
1019368893 7:650534-650556 CTGCCTGCCTGGTGCACTTCTGG + Intronic
1019444891 7:1066208-1066230 CTGTGGGCCTGGGGAAATTCTGG - Intronic
1020434740 7:8150853-8150875 CTGCTTCCCAGGGGCACTTCTGG - Intronic
1024488472 7:49947970-49947992 CTGCAGGCCTGGGGCAATGATGG - Intronic
1026335890 7:69393936-69393958 CTGCTGGCCTCGGGCAATGAGGG + Intergenic
1029975336 7:104828310-104828332 CTGCTGGCCTGGGGAATTTGAGG - Intronic
1033048075 7:137980415-137980437 CGCCTGGCCTGGGGCAGCTCAGG + Intronic
1034462715 7:151206827-151206849 CTGCTGGCCCGGGTCATGCCTGG + Intergenic
1034499288 7:151439729-151439751 CTACTGGCCTGGGGCCTCTCTGG - Intronic
1034530992 7:151696423-151696445 CTGGTGGCCTGGGGCAGGTGAGG + Intronic
1034862650 7:154612955-154612977 GTGCTGGCATGGTCCATTTCTGG + Intronic
1034990309 7:155543779-155543801 ATGCTGGCCTGGGCTACTTCTGG + Intergenic
1035241830 7:157537244-157537266 ATGCTGGGCTGGTGCATCTCCGG - Intergenic
1035405666 7:158595530-158595552 CTGCAGGCCTGAGGCAGCTCTGG - Intergenic
1035559768 8:595505-595527 CTGCTGTCCTGTGGCCTTCCTGG - Intergenic
1036216650 8:6885065-6885087 CTGATGGCTTGGGTCAGTTCTGG - Intergenic
1037683507 8:21118248-21118270 CTACAGGCCTGGGGGACTTCAGG + Intergenic
1040302222 8:46194024-46194046 CTGCCGGCCTGGGGCAGCACTGG - Intergenic
1044944850 8:97380385-97380407 CTCCTGGCCTGGGGATGTTCTGG - Intergenic
1047748436 8:127862645-127862667 CTCCTGGCCTCGGGCAATCCTGG + Intergenic
1048300310 8:133246373-133246395 CTGCTGGTCTGGGGGCTTTGGGG - Intronic
1048504136 8:135005560-135005582 CTGTTTGCCAGGGGCAGTTCTGG - Intergenic
1048622375 8:136147987-136148009 CTGCTGGCCTGATGCATTTCTGG - Intergenic
1048668296 8:136689241-136689263 CTGCTGTCCTGTGGCTTTACAGG + Intergenic
1048853723 8:138669036-138669058 CAGCTTCCCTGGGGCATTCCTGG - Intronic
1049192407 8:141295653-141295675 GTGCTGCCGTGGGGCAGTTCAGG - Intronic
1052056671 9:23914666-23914688 CTGCTGGCCTCGGGCAGTGAGGG - Intergenic
1053471062 9:38346472-38346494 CGGCTGGCCTGGGACTTCTCTGG + Intergenic
1053785573 9:41650407-41650429 GTGCTGCCCTGGGTCTTTTCAGG - Intergenic
1054159459 9:61663770-61663792 GTGCTGCCCTGGGTCTTTTCAGG + Intergenic
1054174292 9:61864373-61864395 GTGCTGCCCTGGGTCTTTTCAGG - Intergenic
1054449150 9:65393418-65393440 GTGCTGCCCTGGGTCTTTTCAGG - Intergenic
1054479231 9:65594775-65594797 GTGCTGCCCTGGGTCTTTTCAGG + Intergenic
1054663246 9:67716418-67716440 GTGCTGCCCTGGGTCTTTTCAGG + Intergenic
1054730423 9:68697429-68697451 CTGATGGCATGGGTGATTTCAGG - Intergenic
1057946035 9:99329429-99329451 CTTCTGGCATGGGGGATTTTAGG - Intergenic
1059390506 9:113996801-113996823 CTGCTGCCCTGTAGCATTTAAGG + Intronic
1059529589 9:115023609-115023631 CCCCTGGCCTGGGGCATCTTTGG - Intronic
1060874351 9:127069663-127069685 CTCCTGAACTGGGGCATGTCAGG + Intronic
1061037226 9:128120587-128120609 CCGCTGGCCTGGGGCTTCCCAGG - Intergenic
1061253053 9:129437662-129437684 CTGCTGGCTTGGGGAATTTGGGG + Intergenic
1061466587 9:130785359-130785381 CTGCTGCCCTGGGCCAGCTCTGG + Intronic
1061817170 9:133204482-133204504 CTGCTGGCCTGGCTCACTTCAGG + Intergenic
1062247424 9:135576312-135576334 CTGCTGGACTGTGGCGTCTCTGG - Intergenic
1062425385 9:136503831-136503853 CTGCTGGCTTGGAGCAATCCTGG - Intronic
1062708168 9:137956707-137956729 CCTCTGTCCTGGGGCATTCCTGG + Intronic
1186698799 X:12067313-12067335 CTGCTGGCCATAGGAATTTCTGG - Intergenic
1189134062 X:38531540-38531562 CTGGAGGCATGGAGCATTTCGGG - Intronic
1193227038 X:78995899-78995921 CTTCTGCCCTGGGGCATCACAGG - Intergenic
1194387821 X:93278517-93278539 CTGTGGGCCTGGGGCAGTACTGG + Intergenic
1198310044 X:135421866-135421888 ATGCTGGCCTGGGGGGGTTCGGG + Intergenic
1198427362 X:136533402-136533424 CAGTTGGCCTGGGGCATCTGTGG + Intronic
1200886978 Y:8280375-8280397 CCTGTGGCCTGGGGCATTTACGG - Intergenic
1201396785 Y:13557039-13557061 CTGGTGGCCTGGGACTCTTCAGG + Intergenic