ID: 1173689742

View in Genome Browser
Species Human (GRCh38)
Location 20:44951176-44951198
Sequence TGTGAGCTAGAGTTTTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173689736_1173689742 26 Left 1173689736 20:44951127-44951149 CCTGTGACCATGAAGACCAGAAT 0: 1
1: 0
2: 1
3: 16
4: 151
Right 1173689742 20:44951176-44951198 TGTGAGCTAGAGTTTTTTGGGGG 0: 1
1: 0
2: 1
3: 16
4: 196
1173689737_1173689742 19 Left 1173689737 20:44951134-44951156 CCATGAAGACCAGAATAGATTGA 0: 1
1: 0
2: 3
3: 30
4: 246
Right 1173689742 20:44951176-44951198 TGTGAGCTAGAGTTTTTTGGGGG 0: 1
1: 0
2: 1
3: 16
4: 196
1173689738_1173689742 10 Left 1173689738 20:44951143-44951165 CCAGAATAGATTGAGAAAATGAT 0: 1
1: 0
2: 0
3: 24
4: 303
Right 1173689742 20:44951176-44951198 TGTGAGCTAGAGTTTTTTGGGGG 0: 1
1: 0
2: 1
3: 16
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173689742 Original CRISPR TGTGAGCTAGAGTTTTTTGG GGG Intronic
902277826 1:15352116-15352138 TGTAAGTGACAGTTTTTTGGGGG - Intronic
903430106 1:23290453-23290475 CTTGAGCTTGAGTTTTTTAGAGG - Intergenic
903890081 1:26563786-26563808 TATTAGCTTCAGTTTTTTGGGGG + Intronic
904517068 1:31064985-31065007 TGTGAGCTTGTGTTTTTGGTGGG - Intronic
905517333 1:38571497-38571519 TTTGAGCTAGATTTTATTGTTGG - Intergenic
906813737 1:48855499-48855521 TGAGAGATGGAGTTTTTTGGGGG + Intronic
908028648 1:59976517-59976539 TCTGGGATAGAGTTTTCTGGAGG + Intergenic
909276210 1:73690185-73690207 TGTCTGCTGGAGTTTTCTGGAGG + Intergenic
910120214 1:83779866-83779888 TGAGAGCAAGAGTATTTGGGAGG + Intergenic
911200834 1:95042219-95042241 TGTGAGATAGAGTGTTGGGGTGG - Intronic
911683911 1:100750959-100750981 CTTGATCTAAAGTTTTTTGGTGG + Intergenic
913406263 1:118495275-118495297 AGGGAGCTACACTTTTTTGGAGG + Intergenic
916503243 1:165405119-165405141 AGTGAGTTGGAGTTTTTTGTTGG + Intronic
918173892 1:182026194-182026216 TGTGTGCTAGAGTTTTTAAAAGG + Intergenic
918476941 1:184935189-184935211 TGTGAGGTAGAGATTTTCAGAGG + Intronic
918987781 1:191655636-191655658 TGTGGCTTAGAGTTTTTTGTAGG + Intergenic
921705098 1:218313506-218313528 TGAGAGGTAAAGATTTTTGGAGG + Intronic
921877679 1:220217366-220217388 TGTGAGCCAGAGTATTCTTGAGG + Intronic
922201588 1:223406788-223406810 CTTGGGCTAGAGATTTTTGGGGG - Intergenic
924212253 1:241782569-241782591 TGTGAACTAGAGTTGTTAAGTGG - Intronic
1063482234 10:6385946-6385968 TGTAAGTTAGAGTCTGTTGGTGG + Intergenic
1064822526 10:19353845-19353867 GGGGAGCAAGAGTTTTCTGGTGG + Intronic
1065459152 10:25937593-25937615 GGTGACTTAAAGTTTTTTGGAGG + Intronic
1067574959 10:47403335-47403357 TGTGAGTTTGAGTTTCTTTGGGG + Intergenic
1067676913 10:48388959-48388981 AGTCAGCCATAGTTTTTTGGGGG + Intronic
1074095845 10:110311675-110311697 TGCGAGCCATAGTTTTTTGGGGG - Intergenic
1074128166 10:110546901-110546923 TGTGAGCTAGAGCTGTTGGTTGG + Intergenic
1074889145 10:117720702-117720724 TGTGAGCTAGATTTTTTTCTGGG - Intergenic
1076414327 10:130274519-130274541 TGGGAGATGGACTTTTTTGGGGG + Intergenic
1080096902 11:28418938-28418960 TGTGGGCTAAAGTGTTCTGGGGG + Intergenic
1083770767 11:64865637-64865659 TCTGAGCTAGAGCTTCCTGGTGG - Intronic
1086315389 11:85586119-85586141 TGTTAGCTAGTATTTTGTGGAGG + Intronic
1086368853 11:86136088-86136110 TGCGAGCTGGAGTTTTTGGGAGG + Intergenic
1089457455 11:118633896-118633918 ACTGACCTGGAGTTTTTTGGAGG + Intronic
1090565755 11:127990245-127990267 TTAGAGCTAGAGTGTATTGGGGG + Intergenic
1092033996 12:5314804-5314826 TGTGGGCTATCATTTTTTGGAGG + Intergenic
1093595337 12:20951985-20952007 TGTTTGCTAGAGTTTGCTGGAGG - Intergenic
1093884737 12:24446787-24446809 AGTGTGCTATTGTTTTTTGGGGG - Intergenic
1095382485 12:41612348-41612370 GGTGAGCTAGAGCGTTCTGGAGG + Intergenic
1097898696 12:64852755-64852777 TGTCTGCTGGAGTTTGTTGGAGG + Intronic
1102741169 12:115208736-115208758 ACTGATCTAGAGTTTTCTGGAGG + Intergenic
1103911071 12:124352676-124352698 TTTGAGCTATAGTATTTTAGAGG + Intronic
1104681726 12:130756658-130756680 TATGGACTTGAGTTTTTTGGGGG + Intergenic
1108582525 13:51839270-51839292 GATGAGCTGGAGTTTTTTTGTGG - Intergenic
1109483832 13:62992807-62992829 TGTTAGCCAGAGTTTTGTTGAGG + Intergenic
1109741226 13:66558550-66558572 TCTGTGCCAGAGTGTTTTGGAGG - Intronic
1110926147 13:81154548-81154570 TTTTAGGTAGTGTTTTTTGGGGG - Intergenic
1111628056 13:90814072-90814094 GGTCTGCTGGAGTTTTTTGGGGG - Intergenic
1111991627 13:95122713-95122735 TGTCAGCAAGAGTTTCATGGAGG - Intronic
1113213435 13:108009680-108009702 TGGGGGCTAAAGTTTTATGGGGG - Intergenic
1115917112 14:38328018-38328040 TGTGAGGTAGGGTTTTTAGGAGG - Intergenic
1115947741 14:38681918-38681940 GGTTAGCTAGTGTTTTTTTGAGG + Intergenic
1119490746 14:75030542-75030564 TGTGACCAAGAGTATTGTGGAGG - Exonic
1120146449 14:80983787-80983809 TTTGAGCTAAACTATTTTGGGGG + Intronic
1123910170 15:24957944-24957966 TCTGTGCTAGGGCTTTTTGGAGG + Intronic
1130039031 15:80388640-80388662 TGTGAGCCAGAGTGTTTTGGGGG + Intronic
1138728766 16:59170897-59170919 TGTGGGCTACTGTTTTTTGCTGG + Intergenic
1138806910 16:60100693-60100715 TGTGGCCTAGACTATTTTGGGGG + Intergenic
1138930235 16:61645844-61645866 GGTGAGAGAGAGTTTTTAGGAGG - Intergenic
1139128247 16:64108359-64108381 TGTGTCCTAGTGTTTTGTGGAGG + Intergenic
1139287588 16:65829467-65829489 TGTGAGCTAGTGTGCTCTGGTGG - Intergenic
1140581009 16:76231222-76231244 TGAGAGATAGACTTTATTGGTGG - Intergenic
1140874034 16:79133880-79133902 TTGGAGGTAGATTTTTTTGGGGG + Intronic
1141856057 16:86682258-86682280 TGTGAGCAAGTCTTTTTGGGGGG - Intergenic
1142551481 17:743111-743133 TGTGAGCTAGACCTTTCTGGAGG - Intergenic
1142868759 17:2807422-2807444 GGGGAGCTTGAGGTTTTTGGGGG + Intronic
1144872692 17:18380728-18380750 TGTGAGCTAGACCTGGTTGGGGG - Intronic
1148616057 17:48999878-48999900 TGTGAGCTGGGGCTCTTTGGAGG + Intronic
1155344762 18:24847377-24847399 AGTGACCTAGATTTTTTAGGTGG + Intergenic
1157259999 18:46169332-46169354 GGGGAGCTAGAGGTTTGTGGGGG + Intergenic
1157839642 18:50944673-50944695 TGTGAGCTAGTGTTTTATTCTGG - Intronic
1158399241 18:57105963-57105985 TTGGAGCTAGAGCTTTTAGGAGG - Intergenic
1158508892 18:58072144-58072166 TGTGACCCAGTATTTTTTGGTGG - Intronic
1162700250 19:12509756-12509778 TTTGAGCTAAAGTCTTTTTGGGG - Intronic
1168200389 19:54810932-54810954 TGTGAGGTAGAGTAATTTGCAGG + Intronic
925111267 2:1340123-1340145 TGTTAGCTCCAGTTTTTTGTGGG - Intronic
926214761 2:10898088-10898110 TGTGAGACAGAGCTCTTTGGGGG - Intergenic
926226023 2:10967472-10967494 TGGGAGCAGGAGGTTTTTGGAGG + Intergenic
927766706 2:25816567-25816589 TGTTAGCTAGACTTTGTTGTAGG - Intronic
930944054 2:57049793-57049815 TGTGAGATGGTGTTTTATGGTGG + Intergenic
932843611 2:75111031-75111053 TATGAGCTATAGTGTTTTGAGGG + Intronic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933722018 2:85403370-85403392 TCTGGGCTTGGGTTTTTTGGCGG - Intronic
934921155 2:98346554-98346576 CTTGAGCTGGAATTTTTTGGGGG + Intronic
936772761 2:115934882-115934904 CGGGAGCTTGAGTGTTTTGGTGG + Intergenic
937819447 2:126292210-126292232 TGTGAGCTATGGTTTTTTTTTGG - Intergenic
938225926 2:129616308-129616330 TGTGAGGGAAAGTTTATTGGGGG - Intergenic
938688363 2:133763016-133763038 TGTGGGCCAGAGTTTGTTTGTGG - Intergenic
939374236 2:141343476-141343498 TGTGTGCTAGATATTTTTGTGGG + Intronic
941004269 2:160231853-160231875 AGTTAGCTAGAGTTTGGTGGTGG - Intronic
941211803 2:162648771-162648793 AGTGAGCAAAATTTTTTTGGGGG - Intronic
941249048 2:163138952-163138974 TTTGGGCTAGAGTTTTTAAGGGG + Intergenic
941551921 2:166927497-166927519 TGTGGGCCAGAGATTTTAGGTGG - Intronic
941826613 2:169905223-169905245 TGTGGCCAAGAGATTTTTGGAGG + Exonic
942134749 2:172913513-172913535 TGGGAGCTAGAATTATCTGGAGG + Intronic
942738112 2:179139819-179139841 TCTGAGCTGGAGTTTTTAAGGGG - Intronic
944431980 2:199644078-199644100 GGTGAGCTAGTGTGATTTGGGGG + Intergenic
945073963 2:206018577-206018599 TGTGAGTTTGAGTTTGTTGCTGG - Intronic
945195207 2:207231089-207231111 AGTGACCCAGATTTTTTTGGGGG - Intergenic
946140477 2:217686450-217686472 TATCATCTAGACTTTTTTGGTGG - Intronic
946912565 2:224479625-224479647 CGTGTGCTAAAGTTTTTTAGGGG + Intronic
948177029 2:235951877-235951899 TCTTAGCTACAGATTTTTGGTGG + Intronic
1169017309 20:2302426-2302448 TCTAAGCTATTGTTTTTTGGGGG - Intronic
1169779910 20:9297786-9297808 TGTGTTCTAGAGGATTTTGGAGG + Intronic
1170229288 20:14027679-14027701 GGTCAGCTGGAGTTTCTTGGAGG + Intronic
1170709930 20:18781478-18781500 TGTCAGCTAGTGATCTTTGGTGG + Intergenic
1171253330 20:23667347-23667369 TGTGAGCTAGACTTTTAAGGAGG + Intergenic
1171259801 20:23722601-23722623 TTTGAGCTAGACTTTTAAGGAGG + Intergenic
1171268879 20:23798132-23798154 TGTGAGCTAGACTTTTAAGGAGG + Intergenic
1172214819 20:33227730-33227752 TCAGAGCTAGAGTTTATTGTAGG - Exonic
1172677854 20:36687305-36687327 TGTTATGTACAGTTTTTTGGGGG - Intronic
1173127532 20:40353729-40353751 TGTGAACCAGAGCTTCTTGGAGG - Intergenic
1173689742 20:44951176-44951198 TGTGAGCTAGAGTTTTTTGGGGG + Intronic
1177319298 21:19499628-19499650 TGAGATCTAGACTTTTGTGGAGG + Intergenic
1178218931 21:30633239-30633261 TGTCAGGTTGAGTTTTTTGTTGG - Intergenic
1178478502 21:32958325-32958347 TGTGAACTAGGGTTTAATGGGGG + Intergenic
1182170141 22:28220506-28220528 TGAGAGCTTCAGTTTTTTGCTGG + Intronic
1184548730 22:45192081-45192103 TTTGAACTAGAGTGTGTTGGAGG - Intronic
949826886 3:8174907-8174929 AGTGAGCTCAAGTTTTTTGTGGG + Intergenic
952363844 3:32657542-32657564 TGTGAACTTGAGGTTTGTGGGGG + Intergenic
955066819 3:55540621-55540643 GGTGAACCAGAGTATTTTGGAGG + Intronic
956510454 3:69988126-69988148 TCGGAGCTAGAATCTTTTGGAGG + Intergenic
957397104 3:79655904-79655926 TGTGAATTAGAGTTTTTTTATGG + Intronic
957719762 3:83978735-83978757 TATGAGTTAGAGTTTTCTGTAGG - Intergenic
958170166 3:89929222-89929244 TGAGAGCTAGTTTTTTTGGGGGG - Intergenic
958476047 3:94584487-94584509 GGTGTGCAAGAGATTTTTGGTGG - Intergenic
958493877 3:94817104-94817126 TGTTAGCTGGAGGTTTTTGCAGG - Intergenic
958622125 3:96575537-96575559 TGTCTGCTAGAGTTTGCTGGAGG + Intergenic
959906666 3:111717944-111717966 TGTGAGGTAGAAATATTTGGTGG - Intronic
960040478 3:113145229-113145251 TGTGAGTCAGAGTGTGTTGGTGG - Intergenic
961146823 3:124600989-124601011 AGTAAGCTAGAGCTTTTTGTGGG + Intronic
962323895 3:134416741-134416763 AGTGATCTAGATTTTTTTGCAGG - Intergenic
963740867 3:149079569-149079591 TGTGAGCAAAGGTTTTTTTGGGG + Intronic
964023161 3:152039967-152039989 TGTGGCCTAGAGTTTTTGTGTGG + Intergenic
965094633 3:164209309-164209331 TGTTAGCCAGAGTTTTCTAGAGG - Intergenic
965940440 3:174173190-174173212 TATCAGCTCTAGTTTTTTGGTGG + Intronic
972904765 4:43731197-43731219 CTTGAGGTAGTGTTTTTTGGTGG - Intergenic
976740855 4:88355894-88355916 TTTAACCTAGAGTTTTTTGCTGG - Intergenic
980722195 4:136713070-136713092 TGTGAGTTGAAGTTCTTTGGAGG + Intergenic
982799637 4:159688256-159688278 TTGGAACTAGAGTTTTTTGAAGG + Intergenic
983455755 4:167962108-167962130 TGTTTGCTAGTGTTTTTTTGAGG - Intergenic
983926822 4:173411804-173411826 TCTAAGCTACAGTTTTATGGAGG + Intergenic
988329736 5:29820008-29820030 TTTCAGCAATAGTTTTTTGGCGG - Intergenic
989195009 5:38707994-38708016 ATTGAGCAAAAGTTTTTTGGTGG - Intergenic
989527093 5:42466115-42466137 TGGGAGCTTGAGTTGTGTGGAGG + Intronic
992855530 5:80857021-80857043 TGTTAGCTAGAGGTTGTTTGTGG + Intronic
994192033 5:96879351-96879373 TTTAAGGTAGGGTTTTTTGGGGG + Intronic
995967678 5:117928824-117928846 TGTGAACTAGAAGATTTTGGAGG - Intergenic
998644698 5:144048954-144048976 GGTCAGCTACAGTTTTCTGGGGG - Intergenic
999701869 5:154235543-154235565 TATGTGCTTGAGTGTTTTGGGGG + Intronic
1003253702 6:4456139-4456161 TGTGAGGTGGAGTTTTCTGCTGG + Intergenic
1004406585 6:15338725-15338747 TGAGAGCAAGAATTTTTAGGAGG - Intronic
1005435444 6:25806122-25806144 GGTTAGCTAGAATTTTGTGGAGG - Intronic
1007842275 6:44726605-44726627 TTTGTGATACAGTTTTTTGGGGG - Intergenic
1008007935 6:46432174-46432196 TGTAAGCTTTAGTGTTTTGGGGG + Intronic
1009832626 6:68957874-68957896 TGTCAGTTGGAGTTTTGTGGGGG + Intronic
1011326824 6:86157666-86157688 TCTGAGGTAAAGTTTTCTGGGGG - Intergenic
1012998343 6:105994923-105994945 GGAGGGCTTGAGTTTTTTGGCGG + Intergenic
1013683254 6:112548208-112548230 TTTGTGCTAGGCTTTTTTGGGGG + Intergenic
1014568871 6:122984832-122984854 TGAGTGCTAGTGTTTTTAGGTGG + Intergenic
1015231311 6:130917769-130917791 AATGAGATAGATTTTTTTGGGGG - Intronic
1016050016 6:139521107-139521129 TGTAATCTGTAGTTTTTTGGAGG + Intergenic
1016223464 6:141705010-141705032 TGTGAGCCAGAATTCTTTGTAGG + Intergenic
1017030124 6:150213804-150213826 TTTGGGCTAGAGGTCTTTGGTGG + Intronic
1018888872 6:167966228-167966250 TAGGAGCTGGATTTTTTTGGAGG - Intronic
1019097156 6:169591597-169591619 TTTTAGCTATAGCTTTTTGGGGG + Intronic
1019839286 7:3423466-3423488 TATAAGATAGATTTTTTTGGGGG + Intronic
1021469824 7:20989230-20989252 TGTAACCTACATTTTTTTGGTGG + Intergenic
1023322994 7:39020109-39020131 TGGGAGCTAGCTTTTTTGGGGGG - Intronic
1024720715 7:52135169-52135191 TGAAGGCTAGAGTTTTTTTGAGG + Intergenic
1028186943 7:87797667-87797689 CGTCAGTTAGGGTTTTTTGGTGG + Intronic
1028817581 7:95164986-95165008 TGTGACATGGAGTTTTTTGGGGG - Intronic
1029018860 7:97343041-97343063 TGTGAGTTAGACTTTTTTTCTGG + Intergenic
1032683791 7:134210476-134210498 TGTAAGAGAGAGATTTTTGGAGG + Intronic
1033839701 7:145359458-145359480 TCTGAGCTGGAGTTTTTAAGGGG + Intergenic
1034613379 7:152392781-152392803 TGTGAAGCAGTGTTTTTTGGAGG - Intronic
1038393990 8:27233162-27233184 TGGAGGCTAGGGTTTTTTGGTGG - Intergenic
1040731030 8:50447165-50447187 TTTGAGATAGAGTTTTTCTGAGG - Intronic
1041019684 8:53626328-53626350 TGTGATCTAGTGATTTTTTGTGG - Intergenic
1042512353 8:69625236-69625258 TTTGAACTTGAGTTTTTTGGTGG + Intronic
1044509362 8:93057765-93057787 GGTGTGCTGGAGTTTTCTGGAGG + Intergenic
1044586585 8:93874402-93874424 TGGGGGCTAGAGGTTTTTGAAGG + Intronic
1044741374 8:95330328-95330350 TGTGAGTGTGTGTTTTTTGGGGG + Intergenic
1045185073 8:99829865-99829887 GGTCTGCTAGAGTTTTCTGGGGG + Intronic
1045948632 8:107826688-107826710 TCTGAGTTAAAGTTTGTTGGAGG + Intergenic
1047659316 8:127015678-127015700 TGTGGGCTAGTGTTATTGGGAGG - Intergenic
1048133752 8:131725616-131725638 AATGATCTTGAGTTTTTTGGTGG + Intergenic
1048613397 8:136048546-136048568 TTTGAGCTAAACTTTTTTGATGG - Intergenic
1049339734 8:142105667-142105689 GGTGAGCTAGAGCCTTTTGAGGG - Intergenic
1051980367 9:23007353-23007375 TGTGAGCTAATGATTTTTGAGGG - Intergenic
1054890876 9:70250432-70250454 GGTTAGCTAGAGTTCTTTGTTGG - Intergenic
1055420895 9:76140538-76140560 TGTGAATTAGAATTTTTTGGGGG + Intronic
1056083944 9:83126197-83126219 TAGGAGGTAGAGTTTTTCGGAGG + Intergenic
1059463946 9:114453765-114453787 TCTGGGCTTGAGTTTTTTTGGGG - Intronic
1203771100 EBV:50533-50555 TTTGTGCTTGCGTTTTTTGGGGG + Intergenic
1185716059 X:2343147-2343169 TGTGAGGGAGAGTTTATTGCAGG - Intronic
1186135149 X:6511704-6511726 TTTAAGCAAGAGTTTTCTGGTGG + Intergenic
1186337307 X:8604152-8604174 TGAGAGCTAGTGTTTTCTGAGGG + Intronic
1188606094 X:32032046-32032068 TATGAGCTACATATTTTTGGGGG + Intronic
1190063488 X:47225193-47225215 TGAAAGCCAGAGTGTTTTGGGGG - Intronic
1190417890 X:50199142-50199164 CGTGAGCTGGAGTTTTTTGAAGG - Intronic
1190426756 X:50340546-50340568 TGTGAGCTAGATTCTATTGGTGG - Intronic
1192261021 X:69505824-69505846 TTTGAGCAAGTTTTTTTTGGCGG - Exonic
1194139959 X:90196831-90196853 GGTCTGCTGGAGTTTTTTGGAGG - Intergenic
1194643680 X:96432092-96432114 TGTGAGGTAGAGTCTTTAGCTGG - Intergenic
1195033800 X:100952322-100952344 TGTTAGCTCTAGTTTTTTGGTGG - Intergenic
1195221755 X:102750756-102750778 TTTGAGCTAGACTATTTTGGGGG + Exonic
1197071180 X:122299860-122299882 GGTCTGCTGGAGTTTTTTGGAGG + Intergenic
1197300565 X:124774956-124774978 GATGTGCTAGAGTGTTTTGGAGG - Intronic
1197514892 X:127414613-127414635 TGTGGGCTAGAGTTATTTTATGG + Intergenic
1197578952 X:128257621-128257643 TGTTGGCTAGAGTATTTTGTAGG - Intergenic
1197732851 X:129826774-129826796 TGTGAGCTATAACTATTTGGGGG - Intronic
1199253448 X:145691434-145691456 AGTTTGCTAGAATTTTTTGGGGG + Intergenic
1201618423 Y:15927754-15927776 TTTAAGCTAGAGTTTTCTGGTGG + Intergenic