ID: 1173691394

View in Genome Browser
Species Human (GRCh38)
Location 20:44963971-44963993
Sequence TTGTCTAAGGCCCTGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173691394_1173691398 -5 Left 1173691394 20:44963971-44963993 CCTTCCACCAGGGCCTTAGACAA 0: 1
1: 0
2: 2
3: 8
4: 124
Right 1173691398 20:44963989-44964011 GACAACCACAAATCCACCACAGG 0: 1
1: 0
2: 1
3: 9
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173691394 Original CRISPR TTGTCTAAGGCCCTGGTGGA AGG (reversed) Intergenic
901600710 1:10421418-10421440 TTGTCAAAGGCACTGTTCGAGGG + Intergenic
905239930 1:36575015-36575037 GTGTCTAAGGCCTTGGTATAGGG - Intergenic
907294753 1:53443312-53443334 ATGTCTAAATCCCTGGGGGAGGG + Intergenic
908145983 1:61244363-61244385 GTGTCTAAGGCCTTGGCAGAAGG - Intronic
908475270 1:64481348-64481370 ATATTCAAGGCCCTGGTGGAAGG + Intronic
915082872 1:153363974-153363996 TTGTTTCAGACCCTGGGGGAAGG + Intergenic
915758752 1:158289779-158289801 TTGTCTAAGGCAGTTGAGGAAGG + Exonic
915758825 1:158290481-158290503 TTGTCTAAGGCAGTTGAGGAAGG + Intronic
921047973 1:211490844-211490866 TTGTGTCAGGCCCTGGTGGCTGG - Intronic
924670007 1:246114525-246114547 TTTTCTAGGGCCATGCTGGAGGG - Intronic
924832744 1:247614955-247614977 GTGCCCAAGGCCATGGTGGACGG + Intergenic
1069029204 10:63577675-63577697 ATTTCTGAGGCCCAGGTGGATGG - Intronic
1071824210 10:89308414-89308436 GTGACTAAGGGCCTGGTGCAAGG + Exonic
1072551022 10:96477827-96477849 ATCTCTAAGGCCCTGGGAGACGG + Intronic
1073947491 10:108767749-108767771 TTGTCTAAGCCAGTGGGGGATGG - Intergenic
1074961929 10:118454767-118454789 TTTTCTAAGGTTCTGGTGTAGGG - Intergenic
1075416930 10:122271198-122271220 GTGTCCAAGGCCCTGGCTGATGG - Intergenic
1075648679 10:124113184-124113206 TTTTCTAGGGCCCTGATGGGAGG - Intergenic
1076871253 10:133196157-133196179 TGCTCTTAGGCCCTGCTGGAGGG + Intronic
1077535120 11:3120345-3120367 ATTCCTAGGGCCCTGGTGGAGGG - Intronic
1080392053 11:31857463-31857485 TTATATAGGGCCCTGGTGGGAGG + Intronic
1080394405 11:31876453-31876475 TTGACTCAGGCCCTGGTGCAGGG - Intronic
1083955669 11:65981647-65981669 CTGGCTGAGGCCCTGGTTGAGGG - Intergenic
1087772646 11:102227305-102227327 CTGTCTATGGCCCTGAGGGAGGG + Intronic
1089245756 11:117118463-117118485 TTGGTGAAGGCCCTGGTGGTAGG - Intergenic
1089621208 11:119723415-119723437 TGGTCCCAGGCCCTGGTGGAGGG - Intronic
1089775188 11:120830990-120831012 ATGCCTAGGGCCCTGGTGGGAGG - Intronic
1095470802 12:42534857-42534879 TTGTCTAAAGCCATGGAGTAAGG + Intronic
1097158801 12:57031116-57031138 TTGTCTAAGACGTTTGTGGATGG + Exonic
1102962660 12:117102690-117102712 TTGTCTAGAGCCCTGGAAGAGGG + Intergenic
1103827056 12:123747423-123747445 TTGTCTGTGGCCCTGGTTTAAGG + Intronic
1109224142 13:59672148-59672170 CTAACTAAGGCCCTGGCGGACGG + Intronic
1113586410 13:111469036-111469058 TTGGCTAAGGCTCTGATGGCTGG + Intergenic
1116574310 14:46553191-46553213 TGGAGGAAGGCCCTGGTGGAAGG + Intergenic
1123539052 15:21269235-21269257 CTTTGTAAGGCCCAGGTGGATGG + Intergenic
1124207071 15:27730277-27730299 TAGTGTAAGGTCCTGGGGGAAGG + Intergenic
1127920912 15:63493484-63493506 TTGTGCTAGGCCCTGGTAGATGG + Intergenic
1128144795 15:65327086-65327108 TTGTGTCAGGTCCTGGGGGAGGG - Intergenic
1128646542 15:69382860-69382882 TTTTCTATGATCCTGGTGGAGGG + Intronic
1129175966 15:73839890-73839912 TTCTGCAAGGCCCTGATGGAGGG + Intergenic
1132195702 15:99913258-99913280 TTGTCCAGCGTCCTGGTGGAAGG - Intergenic
1133314945 16:4877088-4877110 GTGGCCAAGGCCATGGTGGAAGG - Exonic
1135617297 16:23922724-23922746 GTGGCTAAGGCCCTGGAGGAAGG - Intronic
1138335802 16:56251972-56251994 TCCTCTGAGGCCCTGGTGCATGG + Intronic
1139435891 16:66936149-66936171 TTGTCTGAGGCCCCTTTGGAGGG - Intronic
1139438266 16:66949196-66949218 TTGTCTGAGGCCCCTTTGGAGGG - Intergenic
1141807271 16:86350012-86350034 TTCTCTAAGGCAGTGGTGGGAGG + Intergenic
1143382930 17:6507733-6507755 ATGTGTCAGGCCCTGGAGGAGGG + Intronic
1143404978 17:6671343-6671365 TTTGGTGAGGCCCTGGTGGAAGG - Intergenic
1145389808 17:22446809-22446831 ATTTCTAAGGCTCTGGTGGCAGG + Intergenic
1153577193 18:6534275-6534297 TAGTCTCAGGCTATGGTGGAAGG + Intronic
1162316024 19:9938445-9938467 TTGTCAAGGGCGCTGGTGGGTGG + Intergenic
1163456997 19:17412814-17412836 CTGTCTCAGGGTCTGGTGGAGGG + Intronic
1168475802 19:56674134-56674156 TTATTTAAGGCCGAGGTGGAAGG - Intergenic
925937360 2:8777755-8777777 TTGTCTAAGGTCCCGATGCAAGG + Intronic
928034602 2:27810264-27810286 GTGTCTAAGGCACAGGTGGTAGG + Intronic
931032172 2:58189078-58189100 TTGCCTGAGGCCCTGGTGGAAGG + Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
938294701 2:130170815-130170837 TTGTCTGAGGCCAAGGTGGACGG + Intronic
940185619 2:150981922-150981944 TTTTCTTTAGCCCTGGTGGAGGG - Intergenic
941396301 2:164977913-164977935 CTTTGTAAGGCCCAGGTGGATGG + Intergenic
941537746 2:166743003-166743025 TTGCCCAAAGCCCTGTTGGATGG - Intergenic
943872545 2:193019695-193019717 TTTCCAAAGACCCTGGTGGAAGG - Intergenic
948157795 2:235798479-235798501 TTTTTTAAGGACATGGTGGAAGG + Intronic
1168954006 20:1821503-1821525 TTGTTCTAGGCCCTGTTGGAAGG - Intergenic
1169193183 20:3670385-3670407 CTGCCTAGGGCCCTGGTGCAGGG + Intronic
1172595888 20:36150954-36150976 TAGTCAAGGGCCCTGGTGGCTGG + Intronic
1173691394 20:44963971-44963993 TTGTCTAAGGCCCTGGTGGAAGG - Intergenic
1182423174 22:30258191-30258213 ATGTCCCAGCCCCTGGTGGAGGG + Intergenic
1183280335 22:36928863-36928885 TGTGGTAAGGCCCTGGTGGAGGG + Intronic
1184352536 22:43954097-43954119 GTGTGTGAGGCCCTGGAGGATGG - Intronic
1184599096 22:45532185-45532207 CTGTCCAGGGGCCTGGTGGAGGG + Intronic
1184744846 22:46450245-46450267 TGGACAAAGGCCCTGGTGGCTGG - Intronic
1185345796 22:50310019-50310041 TTGCAGAGGGCCCTGGTGGAGGG + Exonic
951523030 3:23626910-23626932 TTCTCTAAGGCCCTTGGGTATGG + Intergenic
951997633 3:28748766-28748788 TTCTCTAAGGAGCTGGTAGATGG + Intergenic
956811515 3:72867967-72867989 TTGTACATGGCCATGGTGGAAGG - Intergenic
960155351 3:114292772-114292794 TTGTCTAAGGGTCTGGAGGTGGG + Intronic
962427028 3:135279304-135279326 TTGCATTATGCCCTGGTGGACGG - Intergenic
962453951 3:135548015-135548037 CTTTGGAAGGCCCTGGTGGATGG + Intergenic
962594685 3:136928763-136928785 CTGTCTCAGGCCCTAATGGAGGG - Intronic
965176791 3:165345257-165345279 ATGTAGAAGGACCTGGTGGAAGG + Intergenic
965717227 3:171618095-171618117 TTCTCTAAGGCACTTGGGGAAGG + Intronic
967451405 3:189627716-189627738 TTGTCTAAGGCCAGGGGTGAGGG + Intergenic
969544557 4:7816778-7816800 GTCTCCAAGGCCCTCGTGGAAGG - Intronic
969705009 4:8786898-8786920 GTGACAAAGGCCCTGGAGGATGG - Intergenic
969718852 4:8882059-8882081 TCCTCTATGGCGCTGGTGGAAGG - Intergenic
971091335 4:23349084-23349106 TTGTTTAAGCCACTGGTGTATGG + Intergenic
975379110 4:73678313-73678335 TTTGCTTAGGCCATGGTGGAAGG - Intergenic
976185258 4:82436795-82436817 TTGTCTAAGGCTCATGTGGTAGG - Intronic
985167997 4:187117848-187117870 TTGTCTATAGCTCTGGTGGCTGG + Intergenic
985599597 5:819881-819903 CTGTCTAAGGCACTGGTCTAGGG - Intronic
985600339 5:825521-825543 CTGTCTTAGGCACTGGTGTAGGG - Intronic
985656664 5:1135355-1135377 TTGTCCAAGGCCCTGGAAAACGG - Intergenic
987370222 5:17186396-17186418 TGGTCGCCGGCCCTGGTGGAAGG - Intronic
991709327 5:69392342-69392364 TTGTATAAGGCTCTGTTGGCTGG - Intronic
992449008 5:76858821-76858843 TAATCTGAGGCCCTGCTGGATGG + Intronic
996496315 5:124161313-124161335 TTGGATAGGGCCCTGGGGGAGGG + Intergenic
997407546 5:133663808-133663830 TTGTCAAAGGCCCTGGTCTGAGG - Intergenic
1001480973 5:172089084-172089106 TTGTTTAAGGGACTGGTGGAGGG - Intronic
1001547708 5:172580658-172580680 TTGTCTCAGGCCCTCTTGGAAGG + Intergenic
1003233454 6:4275331-4275353 GTGTGTAAGGCACTGGTTGAAGG - Intergenic
1005862793 6:29914243-29914265 GTTTCTGAGGCTCTGGTGGAAGG - Intergenic
1006581887 6:35082127-35082149 CTGTCCAGGGCACTGGTGGAAGG - Intronic
1007133071 6:39495178-39495200 TCTGCTAAGGCACTGGTGGAGGG + Intronic
1010452603 6:76019566-76019588 TTGTCCATGCCCATGGTGGAGGG - Intronic
1017014685 6:150090583-150090605 TTGCCCCAGGCCCTGATGGAAGG + Intergenic
1018622393 6:165743003-165743025 TTGTCTCAGAGCCTGGTGGCTGG + Intronic
1022048127 7:26639364-26639386 TTGTTTAAGGCCCTGGTCCGTGG + Intronic
1022429501 7:30302488-30302510 GTTTCCAAGGCCCTGATGGATGG - Intronic
1024740284 7:52346424-52346446 TATTCTAAGGTCCTGGTGGCTGG + Intergenic
1026015292 7:66667069-66667091 TCCTCCAAGGCTCTGGTGGAGGG + Intronic
1029523093 7:101076971-101076993 ATATCTGAGACCCTGGTGGAAGG + Intergenic
1032333528 7:131002802-131002824 TTGGCTAGGGCTCAGGTGGATGG - Intergenic
1033227754 7:139574678-139574700 TTGTCCCAGGACCTGGAGGAAGG - Intronic
1035560290 8:599229-599251 TTTTCTATGGACCTGGTGGTGGG - Intergenic
1037196249 8:16193825-16193847 TTGTATAAAACCCTGATGGATGG - Intronic
1038155433 8:24985052-24985074 TTGTGTTAAGCCTTGGTGGAAGG + Intergenic
1046357431 8:113107041-113107063 TTGTCTAAGGCCCAGGGGGAAGG - Intronic
1047440942 8:124877997-124878019 GTCTCTAAGGCCCTGCTGGCAGG + Intergenic
1048429281 8:134353868-134353890 CTGGCTAAGCCCCTGGTGGCAGG - Intergenic
1048750254 8:137664741-137664763 TTGTCTCTGACCCTGGTGAATGG + Intergenic
1049397661 8:142409087-142409109 TCGTCTAAGGCCCATGTGGCTGG + Intergenic
1049983054 9:922316-922338 TTGTCTAGTGCCCAGATGGAGGG + Intronic
1050286323 9:4106107-4106129 TTGTCTAAGGTGTTGGTGGAAGG - Intronic
1051607068 9:18926721-18926743 TGGGCTCAGGGCCTGGTGGAGGG - Intergenic
1056039865 9:82653088-82653110 ATGGCTAAAGCCCTTGTGGAGGG - Intergenic
1062389753 9:136329268-136329290 TCGTCACAGGCCCTGCTGGAGGG - Intronic
1062509092 9:136895015-136895037 TTGGCTGAGTCCCTGGTGAATGG + Intronic
1187242696 X:17528079-17528101 TTGTCTAGGGCAGTGGGGGAGGG + Intronic
1190714907 X:53094800-53094822 TTTTCTAAGGACCGGGTGCAGGG - Intergenic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1194745378 X:97622309-97622331 TTGTCTCATCCCCTGGCGGATGG - Intergenic
1196030493 X:111091158-111091180 TTCACTAACTCCCTGGTGGAAGG + Intronic
1196299041 X:114033312-114033334 TTTTCTAAGGCCGTGGTTGTAGG + Intergenic