ID: 1173693595

View in Genome Browser
Species Human (GRCh38)
Location 20:44986417-44986439
Sequence TTGTTGAAACAGATTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173693590_1173693595 30 Left 1173693590 20:44986364-44986386 CCAGAAAGGGGAGTGTGCTTAGA 0: 1
1: 0
2: 1
3: 12
4: 155
Right 1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG 0: 1
1: 0
2: 2
3: 16
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173693595 Original CRISPR TTGTTGAAACAGATTGAGCA AGG Intronic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
904046629 1:27613083-27613105 GTGTTGGAACAGGTGGAGCAGGG - Exonic
906692632 1:47802646-47802668 TTGTGCAGACAGAATGAGCAGGG - Intronic
906840420 1:49132618-49132640 TTCATGATACAGATCGAGCAGGG + Intronic
906949785 1:50324966-50324988 ATATTGCAACAGATTGACCATGG + Intergenic
907621061 1:55981144-55981166 TTGTTGCAACAGAGACAGCATGG + Intergenic
908294305 1:62698016-62698038 CTCTTGAAACAGAGGGAGCAGGG + Intergenic
909135359 1:71792421-71792443 TTGGTGAAACAGGATGAGAAGGG - Intronic
909619944 1:77656391-77656413 TTCTTAAGACAGATGGAGCATGG - Intronic
909679063 1:78270993-78271015 TGGTTGGAACAGAGCGAGCAAGG - Intergenic
909982582 1:82120605-82120627 TTATTGAAATAGAAGGAGCAAGG - Intergenic
912587756 1:110782265-110782287 TTTCTGAAACAGATTCTGCAAGG + Intergenic
914220728 1:145679607-145679629 CTGGTGCAACAGAATGAGCATGG + Intronic
914473305 1:148002480-148002502 CTGGTGCAACAGAATGAGCATGG + Intergenic
915430977 1:155866667-155866689 ATGTTGAAAAAAATTAAGCAAGG + Intronic
915444285 1:155966077-155966099 TTGGTGTAACAGAAAGAGCATGG - Intronic
915984164 1:160446937-160446959 TGGTTGAAACTGAATCAGCACGG + Intergenic
916291754 1:163174599-163174621 TCCTTGAAAGAGATTGAGAATGG + Intronic
917037424 1:170763905-170763927 TTATTCAAACAGAGTCAGCATGG - Intergenic
918598887 1:186328786-186328808 TTGTGGAAATAGATTGAGCAAGG - Intronic
919304029 1:195807078-195807100 TGGTTGAAATACAGTGAGCAGGG - Intergenic
919837404 1:201584651-201584673 TTCTAGAAACAGACTGAGGAGGG - Intergenic
920059207 1:203216037-203216059 TTCTTCAAACAGAATGACCAAGG + Intronic
920806118 1:209235516-209235538 ATGTTTAGACAGATTGAACATGG + Intergenic
920896878 1:210060038-210060060 ATGCTGAAACAGATGTAGCAAGG - Intronic
923757097 1:236801805-236801827 TTGTTGAAGGTGTTTGAGCAGGG + Intronic
1064353077 10:14594706-14594728 TTGTTGAAAAACACTGATCATGG + Intronic
1064451121 10:15442828-15442850 TTTTTAAAACAGGTGGAGCATGG - Intergenic
1065045055 10:21739535-21739557 TGCTTGAAACACATTGAGCAGGG - Intronic
1066534545 10:36376334-36376356 TTTTTGAAATAGTTTGAGGAGGG + Intergenic
1066600501 10:37100915-37100937 TTACTAAAACAGAATGAGCAAGG + Intergenic
1067509322 10:46882336-46882358 TTGGAGCAACAGATTCAGCATGG + Intergenic
1067652931 10:48169519-48169541 TTGGAGCAACAGATTCAGCATGG - Intronic
1068492633 10:57743162-57743184 TGGCTGGAACAGAGTGAGCAAGG - Intergenic
1068800914 10:61138812-61138834 TTGTTGGAAAAGTTAGAGCAAGG - Intergenic
1070406851 10:76104875-76104897 TGGTTGGGACAGATTGAGAAAGG - Intronic
1070539571 10:77406498-77406520 TTGTTGAAACACAGTGTGCTGGG + Intronic
1070982529 10:80660910-80660932 TTGTTGCAACAGAAAGAGGAAGG - Intergenic
1072237084 10:93462638-93462660 TTCTTGAAAGAGATTGAGCTGGG - Intronic
1073172025 10:101518663-101518685 TGGCTGGAACAGAGTGAGCAAGG - Intronic
1073772883 10:106754609-106754631 TTGTTGAAAAAGATGGGGAATGG + Intronic
1074474455 10:113756856-113756878 CTGTTGAAGCATTTTGAGCATGG + Intronic
1075167176 10:120079275-120079297 TTGTTGGGACAGATTTGGCAAGG + Intergenic
1079517573 11:21287342-21287364 TTGTGAAAATAGATTGAACAGGG - Intronic
1081147113 11:39576154-39576176 TTATTGAAACACATTGCACATGG + Intergenic
1086899066 11:92345837-92345859 TTGAGGAAACAGATTGAGACAGG - Intergenic
1088365176 11:109032790-109032812 TTCTTGAAACAAATTGAGAGAGG - Intergenic
1089133623 11:116231950-116231972 TTGTTTAAATAGAATGAGAATGG - Intergenic
1091142394 11:133246515-133246537 TTGATGAAACAGTCTGTGCAGGG + Intronic
1092055000 12:5501451-5501473 TTGTTGAAACCGATTGCGGGGGG + Intronic
1092157324 12:6291958-6291980 TTGTTGAAAGAAATTAAACAAGG - Intergenic
1093323517 12:17743636-17743658 TTGGTGAAACAGTTTGATTAAGG + Intergenic
1093602199 12:21041434-21041456 TTGATGAAAGAAATTGAGGAGGG - Intronic
1095148117 12:38755722-38755744 TTATTGAAACACATTGACAAGGG - Intronic
1095516310 12:43009836-43009858 TGGTAAAAACAGATTTAGCATGG - Intergenic
1095731011 12:45506758-45506780 TTGTTGAAATAGGCTGGGCATGG + Intergenic
1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG + Intronic
1098522047 12:71443123-71443145 TTCTTCAAACAGATTGATGATGG + Intronic
1098660714 12:73089673-73089695 TTGCTGAAACAAATTAACCAGGG + Intergenic
1098850240 12:75587567-75587589 TTGTTGCAACAGATTCCTCAGGG - Intergenic
1098889848 12:75998522-75998544 TTATTAAAAGAGCTTGAGCAAGG + Intergenic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101520740 12:105479762-105479784 TTGTTGTAACAGAGGGAGCAGGG + Intergenic
1101585365 12:106080946-106080968 TTGCTGAAACATATTTAGAAAGG - Intronic
1101947883 12:109151789-109151811 TTGATGAAACAGTTCAAGCATGG - Intronic
1103490864 12:121318728-121318750 TTGTTGAAAGAGGCTGAGCGCGG + Intronic
1106806464 13:33312883-33312905 TTGTTGAGCCAGATTTACCAGGG + Intronic
1106870693 13:34016061-34016083 TTGTTAAAACTGATTGAGACAGG - Intergenic
1107060653 13:36156265-36156287 TACGTGAAACAGATTGAGCAAGG + Intergenic
1107355562 13:39561828-39561850 TTGTTGAATCAGAGTGAATATGG + Intronic
1107793145 13:44022876-44022898 TTGTTGTTACAGACTGTGCATGG + Intergenic
1109259177 13:60122609-60122631 TTGTTGAGAAAAATTTAGCATGG - Intronic
1109910964 13:68909319-68909341 TTTTTGAAATAGTTTGAGTAGGG + Intergenic
1113363351 13:109652311-109652333 GTGATGAAACAGACTGAGAAGGG - Intergenic
1113545257 13:111143830-111143852 TTGTTGAATGAGAGTGAGCTGGG - Intronic
1114782804 14:25557746-25557768 TTGTTCTAAATGATTGAGCATGG + Intergenic
1115992393 14:39163535-39163557 CTGTGGAGACAGATTAAGCAAGG - Intronic
1116721038 14:48495820-48495842 TTGCTGATACAGAATGAACAAGG - Intergenic
1119645244 14:76343220-76343242 TTGGAGAGACAGATTAAGCAGGG + Intronic
1121960917 14:98258643-98258665 TGGTTGAAGCAGAATGAGAAAGG - Intergenic
1123459242 15:20453937-20453959 TGGTTGAAGCAGAATGTGCAGGG - Intergenic
1123658818 15:22546481-22546503 TGGTTGAAGCAGAATGTGCAGGG + Intergenic
1124265480 15:28229774-28229796 TGGTTGAAGCAGAATGTGCAGGG - Exonic
1124312683 15:28640973-28640995 TGGTTGAAGCAGAATGTGCAGGG + Intergenic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1128352893 15:66903235-66903257 TGGTAGAAACAGAATGAGCTGGG + Intergenic
1130687762 15:86053902-86053924 TTGGTAACACAGTTTGAGCAAGG - Intergenic
1131439282 15:92446859-92446881 TGGTTGAAACAGAGTGAGCAAGG + Intronic
1133846546 16:9459264-9459286 TTGTTAAATCAGATTCTGCAAGG - Intergenic
1134288656 16:12884803-12884825 TTGATGAAACAAATTAAGGAAGG - Intergenic
1134812281 16:17177987-17178009 TTTTTGATTCAGATTGAGGAAGG + Intronic
1136404245 16:30034561-30034583 TTGTTGAGACAGGTTGAGACAGG - Intronic
1139333316 16:66211164-66211186 TTGCTGAAACTGATTCAGCAGGG - Intergenic
1140113500 16:72022821-72022843 TAGTGGAAACAGACTGAGCCCGG + Intronic
1140318734 16:73927097-73927119 TTGTTGAAGCATTTTGAGGATGG + Intergenic
1144154865 17:12489977-12489999 TTGTTGAAATATATTGTGAATGG + Intergenic
1144583808 17:16475754-16475776 TTGTAGAAACGGGCTGAGCACGG + Intronic
1146630182 17:34463981-34464003 TTGTTTAAACATCTTGATCAAGG + Intergenic
1146907749 17:36628972-36628994 CCCATGAAACAGATTGAGCAAGG + Intergenic
1148638662 17:49168723-49168745 TTGCTGGAACAGAGTGAGAATGG + Exonic
1150022932 17:61638723-61638745 TTGATGAAAGAAATTGAGGAGGG + Intergenic
1150507718 17:65716485-65716507 TGGTTGAAAGAGACTGAGCGGGG + Intronic
1151985957 17:77543918-77543940 TTGTTGAAACAGAGTCAGGGTGG + Intergenic
1153420838 18:4903096-4903118 TTTTTGAAACATTTTCAGCAAGG - Intergenic
1158140951 18:54255100-54255122 ATGGTGAAATAGATTGTGCAGGG - Intergenic
1159616958 18:70592085-70592107 CTGTTGAAAAATTTTGAGCAAGG - Intergenic
1159807543 18:72974352-72974374 TGGCTGGAACAGAATGAGCAGGG - Intergenic
1160182823 18:76650495-76650517 TTGTTGAAGCAGTTTGACGATGG + Intergenic
1162543001 19:11309410-11309432 GTGCTGGAACAGAGTGAGCAAGG - Intronic
1165771020 19:38380399-38380421 TTTTTGGAACAAAGTGAGCAGGG + Intronic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
925183630 2:1832519-1832541 TTTAGGAAACAGAATGAGCAGGG - Intronic
929211964 2:39367230-39367252 TTGTTTAGATAGTTTGAGCAAGG - Intronic
930134662 2:47889670-47889692 GTGTTGAAACAGATTGCTAAGGG - Intronic
935279379 2:101504568-101504590 TTGTTGAAACACAGTGGGCTGGG - Intergenic
939120090 2:138105869-138105891 GGGTTGAAGCAAATTGAGCAGGG - Intergenic
939564070 2:143766061-143766083 CTCTTGAAAGAGTTTGAGCAGGG - Intronic
939673684 2:145045401-145045423 TTATTGAAACAGGTGGAGGAGGG - Intergenic
940184994 2:150974321-150974343 TTGTTAAGACAGCTTGAGCAGGG - Intergenic
940967055 2:159850361-159850383 GTGTTGAGCCAGATTGAACAAGG - Exonic
941126369 2:161588858-161588880 TTTTTGAAAGAGTTTGAGCTAGG + Intronic
942786337 2:179706668-179706690 GGGTTGAAACTGACTGAGCAAGG + Intronic
946015606 2:216601790-216601812 TTGTTGAAACAGATTGCTGGTGG - Intergenic
946261169 2:218492340-218492362 TCGTTAAAATAGAATGAGCAAGG + Intronic
948077419 2:235176079-235176101 GTGCTGAAACAAATTAAGCAGGG + Intergenic
948410695 2:237757828-237757850 TTGTTGAAACAGCTGGAGTGAGG + Intronic
1169201179 20:3710930-3710952 TTCTGGAAACAGAAAGAGCAGGG + Intergenic
1171298868 20:24041998-24042020 TGGCTGAAACAGAGTGAGCAAGG - Intergenic
1172027961 20:31962362-31962384 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1172281808 20:33713118-33713140 TTGTTGTAAGATTTTGAGCAGGG - Intronic
1173164606 20:40678169-40678191 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1174952722 20:55060570-55060592 TTGTTGAGAAAGTTTAAGCAGGG + Intergenic
1176960193 21:15150731-15150753 TTATTGCAACAAAATGAGCAAGG - Intergenic
1177014690 21:15771543-15771565 TTGTTGAAGCTGAATGAGCGAGG + Intronic
1177295479 21:19168583-19168605 TTTTTAAAACAGATTGAAGATGG + Intergenic
1178394405 21:32228839-32228861 TTGTTGAAAGAAATTAAGGAAGG + Intergenic
1178870193 21:36367195-36367217 GTTTTGAAACAGAATGAGTAAGG + Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183817377 22:40314411-40314433 TTTTTGCAACTGATTCAGCATGG - Intronic
949808462 3:7980121-7980143 ATGTTGGAGCAGATTGTGCAAGG + Intergenic
950498306 3:13347631-13347653 CTGTTGATACATATTCAGCACGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956331811 3:68118497-68118519 TTGTTGAAAGGTATAGAGCAGGG - Intronic
956737977 3:72253136-72253158 TTGGTGAAACAGTTTGACCTTGG - Intergenic
958067968 3:88569591-88569613 TTTTTGGAACAGTTTGAGTAAGG - Intergenic
958642256 3:96820069-96820091 TAGTGGAAACTGACTGAGCAAGG + Intronic
959501815 3:107115142-107115164 TTGTTGAAACACAGTTAACATGG - Intergenic
959645955 3:108701127-108701149 TTTTTGAAATAGTTTGAGTAGGG + Intergenic
960198162 3:114796539-114796561 TAATTGAAAGAGATGGAGCAGGG - Intronic
962904263 3:139787949-139787971 TGGTTGTAGCAGATTAAGCAAGG - Intergenic
963807664 3:149741587-149741609 TTGTTGAACCAAATGGAGCAGGG + Exonic
966108467 3:176365291-176365313 TTGCTGAACCAGACTAAGCAGGG + Intergenic
967417759 3:189237966-189237988 TTGTTAAAAGAGAGTGAACATGG - Intronic
969105178 4:4802000-4802022 ATTGTGAAACAGATTGGGCATGG + Intergenic
972202729 4:36734661-36734683 TAGTTGAAACAGAGTGCGGAGGG - Intergenic
973815761 4:54617453-54617475 TTGTTGAAATAGGTTGAATAGGG + Intergenic
974568437 4:63610019-63610041 TTTTTGAAATAGTTTGAGAATGG - Intergenic
975049767 4:69847289-69847311 TTATTTAAACATATTAAGCATGG + Intronic
975215015 4:71743063-71743085 TTGAAGAAAAAGATTGATCAAGG + Intronic
976380024 4:84388594-84388616 TTCTGGAAACAGTGTGAGCAGGG + Intergenic
977136374 4:93309937-93309959 TTGTTTATACATATTGTGCAGGG + Intronic
977163171 4:93662024-93662046 TAGCTGGAACAGAATGAGCAAGG - Intronic
977792280 4:101121380-101121402 TTGTTTAAATACATTAAGCAAGG - Intronic
978349319 4:107804790-107804812 TCGGTGGAACAGAATGAGCAAGG + Intergenic
978705449 4:111703889-111703911 TTCTTGAACCAGTGTGAGCAAGG - Intergenic
978787531 4:112626458-112626480 TGGTTGGAACAGAGTGAGCAAGG - Intronic
979374086 4:119924054-119924076 ATTTTGAAACAGATAGAGGAGGG - Intergenic
980772074 4:137387536-137387558 TTGTTAAAACACATAGATCAGGG - Intergenic
980923511 4:139112174-139112196 TTGCTGAAAGAGATTCAGTAGGG - Intronic
981922499 4:150100403-150100425 GTGTAGAAACAGGTTGACCAAGG + Intronic
981967815 4:150627639-150627661 TTGTTGCAACAAATTATGCAAGG + Intronic
982898981 4:160973955-160973977 TTTTTGGAACAGTTTGAGCAGGG - Intergenic
984481501 4:180309443-180309465 TCCTTGAAACAGATTGAATACGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
985220039 4:187694859-187694881 TTGAACAAAAAGATTGAGCAAGG + Intergenic
988714051 5:33807111-33807133 TTGCTGAAACAGACAGAGAAAGG - Intronic
989036504 5:37178323-37178345 TTGTTACAACAGATAGGGCACGG + Intronic
989711942 5:44409105-44409127 TAGCTGGAACAGAATGAGCAAGG + Intergenic
989994318 5:50809742-50809764 TTGTTGAAACAAAAAGACCATGG + Intronic
989994322 5:50809802-50809824 TTGTTGAAACAAAAAGACCATGG + Intronic
994022628 5:95045031-95045053 TTGGTGATACAGATTGTGTAGGG - Intronic
994475839 5:100267861-100267883 TTGGTTAAACAGCTTGTGCATGG + Intergenic
994919565 5:106026131-106026153 TTTTTGGAAGAGATTGGGCAGGG + Intergenic
995086121 5:108111905-108111927 CTGTTGACACACATTGAACAAGG + Intronic
996485323 5:124026884-124026906 TGATTGAAGCAGAGTGAGCAAGG + Intergenic
998102671 5:139447221-139447243 CTGTAGAAACCGAGTGAGCAGGG - Intergenic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
1001238865 5:170052655-170052677 TTTTTGAAACAGACAGATCATGG - Intronic
1001753673 5:174150218-174150240 TTGTTGAGACGGATGGAGGAAGG - Intronic
1003416241 6:5910971-5910993 ATTTTGAAAAACATTGAGCAGGG + Intergenic
1005561124 6:27042149-27042171 TTGTGGAACCAGATTGTACATGG - Intergenic
1006459319 6:34149206-34149228 TTGTTGAAATAAAGTGAGCCTGG + Intronic
1007797367 6:44360820-44360842 TTGTTGAAAAATATTGGGGAAGG - Intronic
1007966906 6:46011763-46011785 TTATTGAAAGAAATAGAGCAAGG - Intronic
1008108461 6:47466337-47466359 TTTTTAAAAGATATTGAGCAAGG + Intergenic
1008661353 6:53671325-53671347 TTGTTGAAACAGAATGCAAACGG - Intergenic
1011704096 6:89983929-89983951 TTGTTGCAACGGACTAAGCAAGG - Intronic
1012013856 6:93829722-93829744 TTTTTGAAATACATTGAGAAGGG + Intergenic
1013237596 6:108211150-108211172 TTGTTTAAACAAACTTAGCAAGG - Intergenic
1014191037 6:118496965-118496987 ATCTTGAAACAGACTGAGCCAGG + Intronic
1019834639 7:3370674-3370696 CTGGTGAAACAGATTGCGAATGG + Intronic
1020216911 7:6199532-6199554 TTTTTGAAAGAGATTTTGCAGGG - Intronic
1020909608 7:14112047-14112069 TGGTTGAAACAAAGTGAGCAAGG - Intergenic
1020963249 7:14832771-14832793 TAGTGGAAGCAGATTGAGCAAGG - Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1022184328 7:27952384-27952406 TTGGTGACACAGATGAAGCATGG - Intronic
1022479764 7:30735070-30735092 TGGAAGAAACAGATTGTGCAGGG - Intronic
1025079134 7:55967006-55967028 TTGCTGAATCAGTTTCAGCAAGG + Intronic
1028105566 7:86873736-86873758 TTGATGAAAAAAATTGAGGATGG + Intergenic
1028566135 7:92233345-92233367 TAGTTGTATTAGATTGAGCAAGG - Intronic
1029172629 7:98641681-98641703 TTGCTGAAAGAGAAAGAGCAGGG - Intergenic
1030960765 7:115918679-115918701 TTGTTGATAGAAATTGTGCACGG + Intergenic
1031080923 7:117256226-117256248 TTGTTTAGAAAGAGTGAGCAAGG + Intergenic
1031130678 7:117829741-117829763 TTGGTCAATCAGTTTGAGCATGG - Intronic
1034915139 7:155032679-155032701 TCTTTGAAAGAGATTGAGCAGGG + Intergenic
1035815615 8:2536913-2536935 TTGATGAAAGAAATTGAGGAGGG - Intergenic
1037023161 8:13998914-13998936 TTTTTGAAAGAGACTGAGCCAGG - Intergenic
1037111762 8:15171256-15171278 AAGTTGAAAGAGATTGTGCAGGG + Intronic
1041863148 8:62536969-62536991 TTGTTGAAACTCAGGGAGCAGGG + Intronic
1043206656 8:77452307-77452329 ATTTGGAAAAAGATTGAGCAAGG + Intergenic
1044130534 8:88518143-88518165 TGGTTAGAACAGAGTGAGCAAGG - Intergenic
1045091552 8:98750694-98750716 TTTTTGAAATAGTTTCAGCAGGG - Intronic
1046274771 8:111944241-111944263 TTGTGGTAAGAGATTGACCAAGG + Intergenic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1047718162 8:127614870-127614892 TTTTTTGAACAGATTGAGCAAGG + Intergenic
1049169121 8:141147502-141147524 TTGTGGAAACAGCGTGTGCAAGG - Intronic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1052828348 9:33194228-33194250 ATGATCAAACAGATTGGGCACGG + Intergenic
1055350601 9:75382870-75382892 TGGTTGAGACAGAGTGAGCAAGG + Intergenic
1056088537 9:83181397-83181419 TTGTTCAATCATATTGAGGAAGG + Intergenic
1057775798 9:98008284-98008306 TTTTTGAAAGAGAGTGAGCCAGG + Intronic
1058478767 9:105369502-105369524 ATGTTGAAACATAGTCAGCAAGG - Intronic
1058568008 9:106307715-106307737 TTTCTGAAACAGATTCAGGAAGG - Intergenic
1059189490 9:112310909-112310931 TGGCTGAAAGAGAATGAGCAAGG + Intronic
1061682857 9:132251568-132251590 TTCTTGAAACATCTAGAGCAGGG - Intergenic
1062514920 9:136928236-136928258 TTGTTAAAACAGATTGATTGAGG + Intronic
1186519976 X:10197327-10197349 TTGTTAAAACATATTGACCTGGG + Intronic
1187486396 X:19708201-19708223 CTTTTGAAACATATTGATCAGGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188013583 X:25083668-25083690 ATCTTCACACAGATTGAGCATGG - Intergenic
1189044382 X:37574749-37574771 TGGTTGAAGAAGAATGAGCAAGG - Intronic
1190032710 X:46990113-46990135 TTGTTGAAACATTTTTATCATGG + Intronic
1193505615 X:82338869-82338891 TTGTGGAAATAGATGGAGAAAGG - Intergenic
1195005013 X:100677277-100677299 TGGTTGAAGCATAGTGAGCAAGG + Intronic
1196189514 X:112780136-112780158 CTGTTGACACAGATTGAGTGTGG + Intronic
1198192163 X:134318171-134318193 TTTTTGAAAGAGTTTGAGAATGG - Intergenic
1201966325 Y:19740585-19740607 GTGTGGAAACTGATTTAGCAGGG - Intronic