ID: 1173699743

View in Genome Browser
Species Human (GRCh38)
Location 20:45058374-45058396
Sequence AAATTGGGGATTTCTTAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173699743_1173699749 11 Left 1173699743 20:45058374-45058396 CCACGCTAAGAAATCCCCAATTT 0: 1
1: 0
2: 0
3: 2
4: 96
Right 1173699749 20:45058408-45058430 CCTGCAAAGTAGCTTACTTAGGG 0: 1
1: 0
2: 0
3: 8
4: 79
1173699743_1173699747 10 Left 1173699743 20:45058374-45058396 CCACGCTAAGAAATCCCCAATTT 0: 1
1: 0
2: 0
3: 2
4: 96
Right 1173699747 20:45058407-45058429 ACCTGCAAAGTAGCTTACTTAGG 0: 1
1: 0
2: 0
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173699743 Original CRISPR AAATTGGGGATTTCTTAGCG TGG (reversed) Intronic
902154257 1:14471120-14471142 AATTTGGGAATGTCTTAGCTGGG - Intergenic
906095461 1:43220727-43220749 TAATTGGGGATTTCTTTAGGGGG - Intronic
920063394 1:203245645-203245667 AAATTGGGGATTATCTAGGGAGG + Intronic
922457756 1:225790499-225790521 AAATTGTTGATTTCTGAGCTGGG + Intergenic
1063984648 10:11489664-11489686 AGAGTGGGTATTTCTTAGAGAGG - Intronic
1070397592 10:76025006-76025028 AAATGGGGGTTTTCTTTGCTAGG - Intronic
1086289840 11:85295299-85295321 ATATTGGGAATTTTTTAGTGGGG - Intronic
1086840029 11:91673530-91673552 AAATTGGGGAAAACTTAGCAAGG - Intergenic
1088251279 11:107862863-107862885 AAATTGGTGATTTATTACAGCGG + Intronic
1095694304 12:45127215-45127237 AAAATGGGGCTTTCTTAATGAGG + Intergenic
1103974251 12:124691873-124691895 AAATTAGGGTTTTATTAGTGAGG + Intergenic
1109163749 13:59008232-59008254 AAATTGGGGATTTGTTTGGTTGG + Intergenic
1109980381 13:69898681-69898703 ACATTAGGGATATCTTAGTGGGG + Intronic
1110204509 13:72896440-72896462 AAATTAGGGATTTCTTGGTTTGG - Intronic
1112849841 13:103691900-103691922 AAATTGCGGAATTGTTAGAGGGG - Intergenic
1112867487 13:103923740-103923762 AAATTGGGGATTTGTTACGGTGG - Intergenic
1114475732 14:22993319-22993341 AAATTGGGGATTTCTGAATATGG - Intronic
1116201374 14:41801984-41802006 AAATTGAGGATGTCTTATGGTGG + Intronic
1117697909 14:58384901-58384923 AAGTTGGTGATTTTTTAGCCTGG + Intergenic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1119268795 14:73282741-73282763 AATTTGGGGATTTGTAAGGGAGG - Intronic
1120740137 14:88099614-88099636 AAATTCGTGATTGCCTAGCGTGG + Intergenic
1121201403 14:92121472-92121494 AAAATGGGGTTTTCTTCGGGTGG - Intronic
1123755093 15:23391543-23391565 AACTTGGGGGTTTCTTAGGCAGG - Intergenic
1125262786 15:37846754-37846776 AAATTTGGGATTTCTTTTGGTGG - Intergenic
1131562853 15:93459250-93459272 CAGTTGGGGCTTTCTTAGGGAGG + Intergenic
1134461277 16:14431458-14431480 AACTTGGGGGTTTCTTAGGCAGG + Intergenic
1138571753 16:57878682-57878704 AAATCGGGGCTTTGTTAGCAAGG + Intergenic
1139018033 16:62713846-62713868 ATATTGTTGATTTCTTAGAGAGG - Intergenic
1140447641 16:75044154-75044176 AACTTTGGAATTTCTTAGAGTGG + Intronic
1146372154 17:32271809-32271831 AAATTGGGGATCTCTTTTGGGGG - Intronic
1146727678 17:35169402-35169424 AAATTGGACTTTTCTTAGGGGGG - Intronic
1149438438 17:56654059-56654081 AATTTGGGGATTTCCCAGAGGGG + Intergenic
1157395816 18:47340019-47340041 ACATTGGGGATCTCTGAGCCTGG - Intergenic
1168100939 19:54140567-54140589 ATATAGGGATTTTCTTAGCGGGG + Intronic
928173649 2:29019948-29019970 AAATAAAGGATTTCTCAGCGAGG + Intronic
937713197 2:125001791-125001813 AAAATGGTGAGTTCTTAGAGTGG + Intergenic
938362970 2:130707310-130707332 AGATTGGGGGTTTACTAGCGAGG + Intergenic
938439354 2:131313939-131313961 AGATTGGGGGTTTACTAGCGAGG + Intronic
940672175 2:156684055-156684077 AAATTGCTGATTTCTTGGCTTGG + Intergenic
940900501 2:159122257-159122279 AAATTAGGGCTTTCTTACAGAGG + Intronic
942662355 2:178279745-178279767 AACTGGGGTATTTCTTAGTGTGG + Intronic
945840619 2:214883644-214883666 AAATGGGGGATTTCATCACGAGG + Intergenic
947270093 2:228325315-228325337 AAATTGAGGTTTTCTGAGAGGGG + Intergenic
948817255 2:240518425-240518447 AAATTGGGGGTTTCATAGCAGGG - Intronic
1170627438 20:18040501-18040523 GAGTTGGAGATTTCTTAGCAGGG + Intronic
1172468638 20:35175137-35175159 GAGTCGGGGCTTTCTTAGCGGGG - Intronic
1173699743 20:45058374-45058396 AAATTGGGGATTTCTTAGCGTGG - Intronic
1174281067 20:49439676-49439698 AAATTGGGGTTCTGTTAGCAAGG - Intronic
1181454439 22:23048476-23048498 AGATTGGGGATTTCTTGGTTTGG - Intergenic
1183988406 22:41582160-41582182 AAAAAGGGTATTTCTTTGCGAGG + Intronic
949744010 3:7267686-7267708 AAATTGGGGATTTTATATAGCGG + Intronic
950494003 3:13323015-13323037 AAATTGTGGCTTTCTTTGCTAGG + Intronic
951426355 3:22550639-22550661 AAGTTGGGCATTTTTTAGTGTGG - Intergenic
955543972 3:60007761-60007783 AAATTGGGGAAAACTTAGCAAGG + Intronic
962093043 3:132265330-132265352 AAATTTGGAATTTCTCAGCCTGG - Intronic
964211409 3:154232492-154232514 AAATTGTGGATTTCTTGACATGG + Intronic
970149031 4:13069503-13069525 ACATTTGGGAGTTCTTAGCATGG - Intergenic
971546993 4:27898437-27898459 AAATTGGGGTTTTTTTGGCCTGG - Intergenic
978151885 4:105446243-105446265 AAATTTGGAATTTATTAACGTGG - Intronic
984512468 4:180694935-180694957 ACAGTGGGGTTTTCTTAGCATGG - Intergenic
990819016 5:59816755-59816777 AAACTGGGTATTTCTTAGGAAGG - Intronic
990821240 5:59842456-59842478 AAACTGGGGATTCCTTAACTGGG + Intronic
992140295 5:73789832-73789854 AGATTTGGGATTTCTTAGTTTGG - Intronic
997329435 5:133048534-133048556 AAAATGAGGATCTCTTAGCCAGG - Intergenic
998472718 5:142395840-142395862 AAATTGGGGTTCTGTTAGTGAGG + Intergenic
999882257 5:155878648-155878670 AAATTGGGATTCTCTTAGCAAGG + Intronic
1002068874 5:176666684-176666706 AACTTGGGTATTTGATAGCGAGG - Intergenic
1004226176 6:13786105-13786127 AAATTGTGTATTTCTCAGCCAGG + Intergenic
1005262936 6:24081408-24081430 CAATTGTGGATTTCTTTGTGGGG - Intergenic
1006407284 6:33852541-33852563 AAATTTGGGATTTTTTGGCCAGG + Intergenic
1017667216 6:156731884-156731906 AAAATAGGTATTTCTTAGAGGGG - Intergenic
1018649299 6:165978589-165978611 AAATTTGGGATTTCTGAAAGTGG + Intronic
1025074220 7:55928521-55928543 GAGTTGGAGATTTCTTAACGTGG + Intronic
1029789051 7:102823237-102823259 AAATTGGTGATGCCTTAGAGAGG - Intronic
1032609870 7:133401330-133401352 AAATTTGGTCTTTCTTAGCAAGG + Intronic
1034683080 7:152946328-152946350 AAATTAGGGATTTCTTGGTTTGG + Intergenic
1039589728 8:38736226-38736248 AAATTAAGGATTTCTGAGAGAGG - Intronic
1044158097 8:88875720-88875742 AATTTGGGCATCTCTTAGTGTGG + Intergenic
1046294640 8:112201797-112201819 AAATAGGGGATCTGTTAGCAAGG + Intergenic
1046445953 8:114319517-114319539 TAATTGGGGAATTCTTGGTGAGG - Intergenic
1047319003 8:123761659-123761681 AAATTGGCTATTTCTTGGCCAGG - Intergenic
1048311208 8:133323644-133323666 AAATAGGGGATTTCTTTTAGGGG - Intergenic
1048977077 8:139679107-139679129 AAACTGGGGTTCTCTTAGTGAGG - Intronic
1055383257 9:75732268-75732290 ACATTCAGGATTTCTTAGCATGG + Intergenic
1055576557 9:77665751-77665773 AAATTGGGGACTTCTAAGTTGGG - Intergenic
1057209385 9:93191477-93191499 AGGTTGGGGAGTTCTGAGCGAGG + Intronic
1057991624 9:99776472-99776494 CAATGAGGGCTTTCTTAGCGGGG - Intergenic
1058285487 9:103171737-103171759 AAATTGGTGAGTTATTAGAGTGG + Intergenic
1059469787 9:114496068-114496090 AAATTGGTGATTTGTTAACATGG - Intronic
1060875410 9:127079787-127079809 AATTTGGGCATGTCTTAGCTGGG - Intronic
1186235560 X:7504927-7504949 AAATTGGGGGTTTTATAGTGTGG + Intergenic
1187540420 X:20187796-20187818 GAATTTGGGATTTTTTAGAGGGG - Intronic
1189975646 X:46459394-46459416 AATTTGGGGATTGCTTAGAAAGG + Intronic
1189983749 X:46535050-46535072 AATTTGGGGATTGCTTAGAAAGG - Intronic
1195299803 X:103517124-103517146 AAAGTGGGGATTACTTTGCCAGG - Intronic
1196043993 X:111237356-111237378 AAATTAGTATTTTCTTAGCGAGG + Intergenic
1198380324 X:136077636-136077658 AAATGGGGCAGTTCTTAGAGAGG - Intergenic
1201068620 Y:10124093-10124115 ATATTGGGCTTTTCTTAGCTGGG + Intergenic