ID: 1173701607

View in Genome Browser
Species Human (GRCh38)
Location 20:45076715-45076737
Sequence TCAGATGGGGAGCCATGACT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173701598_1173701607 6 Left 1173701598 20:45076686-45076708 CCATCTTCCTGCAACTTTACCTC 0: 1
1: 0
2: 4
3: 23
4: 333
Right 1173701607 20:45076715-45076737 TCAGATGGGGAGCCATGACTGGG 0: 1
1: 0
2: 3
3: 17
4: 144
1173701599_1173701607 -1 Left 1173701599 20:45076693-45076715 CCTGCAACTTTACCTCTTTCCCT 0: 1
1: 0
2: 0
3: 30
4: 363
Right 1173701607 20:45076715-45076737 TCAGATGGGGAGCCATGACTGGG 0: 1
1: 0
2: 3
3: 17
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173701607 Original CRISPR TCAGATGGGGAGCCATGACT GGG Exonic
901451316 1:9338372-9338394 GCAGTTGGGGATCCATGCCTAGG + Intronic
902238320 1:15072073-15072095 TCAGATGTGGGGCCAGAACTGGG - Intronic
902935636 1:19762777-19762799 TCAGAGATGGAGCCATTACTGGG - Intronic
905829456 1:41053544-41053566 TCAGCTGGGGTGGCTTGACTAGG - Intronic
907516349 1:54995722-54995744 TGAGATGGGGAGCCATTCCAAGG + Intergenic
907867478 1:58412149-58412171 TCAGCTGGGAAGACATGAGTTGG + Intronic
908835162 1:68222617-68222639 TTAGAGGTGGAGCCATGGCTTGG - Intronic
910911570 1:92240047-92240069 TCAGATGAGGAGACCTGATTGGG + Intronic
916506944 1:165436667-165436689 ACAGAAAGGGAGCCATGACCTGG + Intronic
916785734 1:168085822-168085844 TCAGCTGAGGAGCCAGGCCTGGG + Intronic
919733564 1:200930011-200930033 CCAGATGGGGAGCCATGACAGGG + Intergenic
920047802 1:203145018-203145040 TAAGGTAGGGAGCCATGCCTTGG - Intronic
923362155 1:233222329-233222351 TGAAATGGGGAGCCATTGCTGGG + Intronic
924945876 1:248846720-248846742 TTAGATGGGGATCCTTGTCTGGG - Intronic
1065251454 10:23819244-23819266 TCAGATAGGGCCACATGACTAGG + Intronic
1067466301 10:46501780-46501802 CTGGATGGGGAGCCAGGACTCGG - Intergenic
1067620887 10:47882825-47882847 CTGGATGGGGAGCCAGGACTCGG + Intergenic
1069069478 10:63978550-63978572 TCAAATGGGGTACCATGGCTAGG - Intergenic
1069785168 10:70983201-70983223 TCAGAGGAGGATGCATGACTTGG - Intergenic
1069788103 10:71002536-71002558 TGAGATGGGGAGAGATGCCTTGG - Intergenic
1070453107 10:76581582-76581604 GCAGATTGAGAGCCTTGACTTGG - Intergenic
1070962665 10:80509838-80509860 TCAGATGGTGAGTCATGAGCCGG - Intronic
1070998571 10:80808702-80808724 TCAGATGTGGATCCAGGTCTGGG - Intergenic
1071294247 10:84207760-84207782 TCAGATTGTCAGCCAGGACTGGG + Intronic
1072574543 10:96687989-96688011 TCTGATGGGGAGGCATGAAGGGG + Intronic
1074301928 10:112240820-112240842 TCAGGTCGGGAGCCAGGGCTGGG + Intergenic
1077099207 11:814016-814038 TCAGATGGGAAGGCAAGACCTGG + Intergenic
1077358460 11:2129365-2129387 CAAGATGGAGAGCCACGACTAGG + Intronic
1078729018 11:13959199-13959221 TCAGATTGGGATCTATGACCAGG + Intergenic
1079339657 11:19601550-19601572 CCAGATGGGGTACCATGTCTGGG - Intronic
1080608900 11:33887059-33887081 CCACATGGGAATCCATGACTTGG + Intronic
1081461433 11:43276072-43276094 TCACATGGGGACCCATCACTAGG - Intergenic
1081849779 11:46267098-46267120 TCAGGTGAGGAGACCTGACTTGG - Intergenic
1082864033 11:57882215-57882237 CCAGAGAGGGAGCCATGACATGG - Intergenic
1088763037 11:112950075-112950097 GGAAATGGGGAGCCATGACAGGG + Intergenic
1088777784 11:113102535-113102557 TCAGATTGGAAGCCACTACTGGG + Intronic
1090274334 11:125409059-125409081 TCAGATGAGGAACCGTGGCTAGG + Intronic
1091509067 12:1103366-1103388 TCGAATGGGGAGCCATGACAGGG + Intronic
1092159670 12:6309465-6309487 TCAGACGAGGTGCCATGATTTGG + Intergenic
1092854210 12:12657538-12657560 TCAGCTGGGGAGACCTGACCAGG - Intergenic
1093087075 12:14877765-14877787 TCAGACGGGTAGCAATGTCTGGG + Intronic
1093117185 12:15225684-15225706 TCAGATGTGCAGCCCTGCCTTGG - Intronic
1096335959 12:50756843-50756865 TGAGATAGGGAGCCATGGGTGGG + Intergenic
1096406414 12:51347220-51347242 TCAGATGGAGAGCCAAGAAGGGG + Intergenic
1098520231 12:71427287-71427309 TGAGATGAGCAGCCATTACTGGG - Intronic
1099212787 12:79813959-79813981 TTAGAAGTGGAGTCATGACTGGG + Intronic
1102430477 12:112879257-112879279 TCAGATGGGGATGGATGACCAGG + Intronic
1104457870 12:128930295-128930317 TCAGACTGGGAGCCATGAGCAGG + Intronic
1104947939 12:132425354-132425376 TCACCTGGGGAGCCATGACGGGG - Intergenic
1106079690 13:26489935-26489957 TCACATGGGGAGACCTAACTAGG + Intergenic
1107578376 13:41752591-41752613 TTAGTTGGAGAGGCATGACTGGG + Intronic
1113028548 13:105968765-105968787 TATGTTAGGGAGCCATGACTAGG - Intergenic
1113207095 13:107929704-107929726 TCAAATGGTGAGCAATGGCTAGG + Intergenic
1115875565 14:37857787-37857809 TCAGATGGGGTGTATTGACTGGG + Intronic
1122354216 14:101113529-101113551 TCAGAGGAGGAGACATGACGGGG + Intergenic
1122961707 14:105096852-105096874 TGAGTTGGGGAGCCAGGAATGGG - Intergenic
1124227127 15:27904095-27904117 TGAGAACGGGAGCTATGACTTGG - Intronic
1126226211 15:46273024-46273046 TGGGAAGGGGAGACATGACTAGG + Intergenic
1127826194 15:62705584-62705606 TCAGATGGGGGGCCAGGATTTGG - Intronic
1130843775 15:87725538-87725560 CCAGAAGGGGACCCAGGACTGGG - Intergenic
1131027615 15:89158036-89158058 GAAGATGGGGAGGCATGGCTTGG + Intronic
1132255979 15:100376514-100376536 TGAGATGGGGAGAATTGACTGGG - Intergenic
1132937197 16:2487129-2487151 TCAGATGTGGAGGCAAGAGTGGG - Intronic
1135184062 16:20299623-20299645 CCAGCTGTGGGGCCATGACTGGG - Intergenic
1135536378 16:23297584-23297606 TCAGATGGGGAGCTATATTTTGG - Intronic
1137608213 16:49801122-49801144 TCAGAAGAGGAGCCAAGCCTGGG + Intronic
1138526523 16:57610914-57610936 TGAGATGGGGACCCAGGACAGGG + Intronic
1139686154 16:68605248-68605270 TCAGATGGAGAACCATGAATTGG - Intergenic
1139974719 16:70800641-70800663 GCAGATTGGGAGCCATATCTGGG - Intronic
1141894515 16:86950265-86950287 ACAGGTGGGGAGCCAAGGCTGGG + Intergenic
1142980054 17:3666484-3666506 TCAGATGGGGACCCAGGAGGAGG + Intronic
1144961299 17:19045606-19045628 TCAGATGAGAAACCAAGACTTGG + Intronic
1144973862 17:19128918-19128940 TCAGATGAGAAACCAAGACTTGG - Intronic
1145889040 17:28402158-28402180 GCTGATGGGCAGCCATGGCTGGG - Exonic
1147392429 17:40118490-40118512 TGAGATGGGAAGCCATGAGAGGG + Intergenic
1148119748 17:45201482-45201504 TCAGATGGGGTGCCTGGAATTGG + Intergenic
1149452612 17:56761567-56761589 CCAGAAGGGCAGCTATGACTGGG - Intergenic
1150838237 17:68583932-68583954 TCATTTGGGGAGCCATTATTCGG + Intronic
1152094343 17:78264268-78264290 TCAGCTGGGGAGCCATGCCTGGG - Intergenic
1156845619 18:41662594-41662616 TCACATAGGAAGCCATGAGTTGG + Intergenic
1159087381 18:63809356-63809378 TCAGATGTGGAACAATGAGTAGG + Intergenic
1161239202 19:3212547-3212569 TCAGATGGTGATCAATGGCTGGG + Intergenic
1161588200 19:5117008-5117030 GCAGAGGGGCAGCCATCACTTGG - Intronic
1161811867 19:6475934-6475956 TCAGCTGGGGAGCGATGGCGGGG + Exonic
1162261884 19:9540593-9540615 TCACATTGGGAGCAAAGACTAGG - Intergenic
1162582730 19:11540422-11540444 AGAGATGGGGACCCAAGACTGGG + Intronic
928950467 2:36808960-36808982 TCAGATGGGCAGCCATGGCTGGG - Exonic
928957708 2:36888352-36888374 TGAGATGGGGAGCCATGGGAGGG - Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930586960 2:53278433-53278455 TCAGATGGGGAGCCAGAATGTGG + Intergenic
933806483 2:86001620-86001642 TCAGATGGGGAGTCCTGACCTGG + Intergenic
935881743 2:107572438-107572460 GCAGATGTGGAGCCAGGACGAGG + Intergenic
944057377 2:195537033-195537055 CCAGATGAGGTGCCATGACTCGG + Intergenic
945184090 2:207122225-207122247 TCTGATGGGAAACCATGAGTGGG + Intronic
946009852 2:216555605-216555627 TCAGATGGGACGACGTGACTGGG - Intronic
1171030903 20:21675563-21675585 TCAGCTGGGGATACCTGACTGGG - Intergenic
1171346519 20:24469870-24469892 TCCGAGGCGGAGCCAGGACTAGG - Intronic
1172010136 20:31841812-31841834 TCAGAGGGGGTGCCATGGATGGG + Intergenic
1172954952 20:38749539-38749561 TGAAATGGGGAGCCATGGCAGGG + Intronic
1173701607 20:45076715-45076737 TCAGATGGGGAGCCATGACTGGG + Exonic
1173710796 20:45153860-45153882 TCAGAAGGGGAGCTGAGACTGGG - Intergenic
1174000838 20:47373470-47373492 TCAGGTCGAGATCCATGACTAGG - Intergenic
1174138809 20:48398662-48398684 TCAGATCTGCAGCCATGACTTGG + Intergenic
1175502965 20:59463316-59463338 GCAGATGGGGAAACAAGACTGGG + Intergenic
1177057787 21:16330410-16330432 TAATATAGGGAGCAATGACTTGG - Intergenic
1180133624 21:45845202-45845224 TCAGACAGGAAACCATGACTTGG - Intronic
1181909827 22:26229765-26229787 TCAAATGTGCAGCCAGGACTGGG + Intronic
1182508058 22:30799584-30799606 TCAGATGTGGAGTCAGGCCTAGG - Intronic
1183700978 22:39450916-39450938 TTAGATAGGGATCCATTACTTGG - Intergenic
950990430 3:17432206-17432228 TAAGATGGGGAAAAATGACTTGG + Intronic
951047252 3:18053764-18053786 TCAGATGGGCAGCCATGTTTGGG + Intronic
953455332 3:43036192-43036214 TTATATGGGCAGACATGACTCGG + Intronic
954322509 3:49841749-49841771 AGAGATGGGGAGCAATGACACGG + Intronic
954465762 3:50653874-50653896 ACAGATGGGAAACCAAGACTCGG + Intergenic
954648499 3:52145549-52145571 CCAGATGGGGAGTCCTCACTGGG - Intronic
954754031 3:52829375-52829397 TCAGATTGGGAGCCAGGGTTTGG - Intronic
955034748 3:55256476-55256498 TCAGTTGGGCAGCCCTGAGTAGG - Intergenic
955358211 3:58249634-58249656 TCAGATAATGAGCCAGGACTAGG - Intronic
961524400 3:127487426-127487448 TGAGATGGGGAGACATGATGGGG - Intergenic
962105395 3:132383629-132383651 TCAGATCTGCAGCCATGGCTTGG + Intergenic
964180481 3:153877795-153877817 TCAGCAGGGCAGCCATGACCTGG + Intergenic
964473578 3:157078763-157078785 TAAGATGGGTAACAATGACTAGG + Intergenic
970768442 4:19580024-19580046 TCAGGTGAGGAGCCTTGACCTGG - Intergenic
970934611 4:21554365-21554387 TTTGATGGGGAGCCAAGACTGGG + Intronic
980191496 4:129530517-129530539 TGAGATGGGAAGCCAGGACCAGG - Intergenic
998898324 5:146824268-146824290 TCAGATGGAGATTCATGACATGG + Intronic
999857741 5:155613556-155613578 TGAAATGGGGAGCCATTACAGGG + Intergenic
1002330789 5:178439133-178439155 TCAAAAGGGCAGCCAGGACTGGG + Intronic
1002600315 5:180350803-180350825 TCTCATGGGAAGCCAGGACTCGG - Intronic
1002928453 6:1618500-1618522 TCAGAGCGGGAGCCAGGACCAGG + Intergenic
1003163443 6:3655779-3655801 CCAGATGGGGAGGCTTGACTGGG + Intergenic
1006184158 6:32170886-32170908 TCAGGAGGGGAGGCATGGCTGGG + Exonic
1011284276 6:85706655-85706677 TCAGGTCTGGAGCCATCACTGGG + Intergenic
1011976137 6:93301831-93301853 TCAGATGTCGAGCAATGACTTGG - Intronic
1012096990 6:94975293-94975315 TCACATGGGGAGCAATAACTTGG - Intergenic
1016568352 6:145484817-145484839 GAAGATAGGCAGCCATGACTTGG - Intergenic
1016780604 6:147953476-147953498 TCAGATTGGGAGCCAAAACAGGG - Intergenic
1017367140 6:153656367-153656389 TCAGATGGGGATACCTGATTTGG - Intergenic
1022977143 7:35569198-35569220 TCTGATGGGTAGACATGACTGGG + Intergenic
1024669949 7:51585244-51585266 TCGGATGTGGTGCCATGACATGG - Intergenic
1025122355 7:56315906-56315928 TCAGCTGGGAGGACATGACTAGG - Intergenic
1029224211 7:99013409-99013431 TCACAGGGGAGGCCATGACTTGG + Intergenic
1031922100 7:127609533-127609555 GCAGATGGGGAGGCATGGCTGGG - Intergenic
1034226601 7:149489696-149489718 TCAGATGGAAAGCCAGGACTTGG + Intronic
1034350159 7:150410110-150410132 TCAGGTGTGGAGCCGTGACATGG - Intronic
1035293873 7:157857040-157857062 TCAGCTTGGGCGCCATGAGTGGG + Intronic
1036337439 8:7883575-7883597 CCATACGTGGAGCCATGACTGGG - Intergenic
1038982357 8:32773779-32773801 TCAGGTGGGGAGCCATGGAGGGG - Intergenic
1041391198 8:57348925-57348947 TCAGATGAGGTGCTGTGACTAGG + Intergenic
1044053884 8:87543245-87543267 GCAGATGGGGAGGCATGGCTGGG - Intronic
1048282214 8:133113999-133114021 CCTGATGGGCAGCCAAGACTGGG - Intronic
1049426140 8:142538689-142538711 TCAGCTGGGGAGGCAGGAGTGGG - Intronic
1049982713 9:919619-919641 TGAGATGGGGAGCCATAGCAGGG + Intronic
1051716904 9:19994598-19994620 TCAGATTGAGAGCCAGGAGTTGG + Intergenic
1052437015 9:28443332-28443354 GCAGGTGGGGAGGCATGGCTGGG + Intronic
1055644294 9:78348234-78348256 TTCGATGGGGAGCCATGGCCAGG - Intergenic
1056341251 9:85634536-85634558 TGAGATTGGAAGCCATGACAGGG + Intronic
1057351093 9:94299366-94299388 TCTGAAGGGGAGCCATGCTTTGG - Intronic
1058364047 9:104186743-104186765 TCAGTTGGGCAGCACTGACTTGG + Intergenic
1061065992 9:128277702-128277724 TGAGATGGGGAGCCCAGGCTTGG + Intronic
1188950083 X:36360354-36360376 GCAGATCTGGGGCCATGACTGGG + Intronic
1189371035 X:40429539-40429561 TCAGCTGGGCTGCCTTGACTAGG - Intergenic
1190279327 X:48918905-48918927 GCAGCTGGGGAGCCAGGGCTGGG + Exonic
1192743005 X:73911744-73911766 TCAGATGGGGAGGCATCAGGTGG + Intergenic
1199466986 X:148149210-148149232 TCAGATGGGAAGTAATTACTAGG + Intergenic