ID: 1173702287

View in Genome Browser
Species Human (GRCh38)
Location 20:45083369-45083391
Sequence GGGCAGGTTACTGCAGGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173702277_1173702287 14 Left 1173702277 20:45083332-45083354 CCTGGGCTATTTATTGTAGATAT No data
Right 1173702287 20:45083369-45083391 GGGCAGGTTACTGCAGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173702287 Original CRISPR GGGCAGGTTACTGCAGGTTG TGG Intergenic
No off target data available for this crispr