ID: 1173702357

View in Genome Browser
Species Human (GRCh38)
Location 20:45084233-45084255
Sequence GAAGCTTCCAAGACCATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173702354_1173702357 2 Left 1173702354 20:45084208-45084230 CCTTCTACTCCACTGGGCTCTTT No data
Right 1173702357 20:45084233-45084255 GAAGCTTCCAAGACCATGGATGG No data
1173702355_1173702357 -7 Left 1173702355 20:45084217-45084239 CCACTGGGCTCTTTTAGAAGCTT No data
Right 1173702357 20:45084233-45084255 GAAGCTTCCAAGACCATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173702357 Original CRISPR GAAGCTTCCAAGACCATGGA TGG Intergenic
No off target data available for this crispr