ID: 1173703312

View in Genome Browser
Species Human (GRCh38)
Location 20:45092314-45092336
Sequence CATTATGCAAATAAAGAGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 282}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173703312_1173703319 2 Left 1173703312 20:45092314-45092336 CCCAGCTCTTTATTTGCATAATG 0: 1
1: 0
2: 2
3: 27
4: 282
Right 1173703319 20:45092339-45092361 TTTCACTGATACATGGGAAGGGG 0: 1
1: 0
2: 3
3: 11
4: 179
1173703312_1173703318 1 Left 1173703312 20:45092314-45092336 CCCAGCTCTTTATTTGCATAATG 0: 1
1: 0
2: 2
3: 27
4: 282
Right 1173703318 20:45092338-45092360 TTTTCACTGATACATGGGAAGGG 0: 1
1: 0
2: 2
3: 20
4: 323
1173703312_1173703315 -5 Left 1173703312 20:45092314-45092336 CCCAGCTCTTTATTTGCATAATG 0: 1
1: 0
2: 2
3: 27
4: 282
Right 1173703315 20:45092332-45092354 TAATGGTTTTCACTGATACATGG 0: 1
1: 0
2: 2
3: 18
4: 178
1173703312_1173703317 0 Left 1173703312 20:45092314-45092336 CCCAGCTCTTTATTTGCATAATG 0: 1
1: 0
2: 2
3: 27
4: 282
Right 1173703317 20:45092337-45092359 GTTTTCACTGATACATGGGAAGG 0: 1
1: 0
2: 3
3: 14
4: 181
1173703312_1173703320 27 Left 1173703312 20:45092314-45092336 CCCAGCTCTTTATTTGCATAATG 0: 1
1: 0
2: 2
3: 27
4: 282
Right 1173703320 20:45092364-45092386 CGAGTTGTTGCTTTTCTGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 157
1173703312_1173703316 -4 Left 1173703312 20:45092314-45092336 CCCAGCTCTTTATTTGCATAATG 0: 1
1: 0
2: 2
3: 27
4: 282
Right 1173703316 20:45092333-45092355 AATGGTTTTCACTGATACATGGG 0: 1
1: 0
2: 1
3: 15
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173703312 Original CRISPR CATTATGCAAATAAAGAGCT GGG (reversed) Exonic
900963019 1:5937672-5937694 CCTTATCCAGATAGAGAGCTGGG + Intronic
904657711 1:32061887-32061909 AAATATGCAAATGATGAGCTGGG - Intergenic
905258546 1:36701244-36701266 CATTATGCAAATAAACATGCAGG - Intergenic
905336298 1:37246987-37247009 CATTAGGCAAATAAACATTTTGG - Intergenic
905391385 1:37637976-37637998 GATAATGCATTTAAAGAGCTTGG + Intergenic
905853078 1:41288607-41288629 CATTATGCCAATCATGAGCTGGG + Intergenic
907058592 1:51397229-51397251 GACAATGCATATAAAGAGCTTGG + Intronic
908046116 1:60170826-60170848 AATGATGGAAATAAAGTGCTTGG - Intergenic
908139977 1:61174174-61174196 CATTATGCAGATGGAGAGGTCGG + Intronic
910080592 1:83337224-83337246 CACTCTGAAAATAAAGAGGTAGG - Intergenic
910791189 1:91052900-91052922 CTTTATGCAAAGAAAGACTTAGG + Intergenic
910830033 1:91451766-91451788 CATTATTCAAATAAAGAAACAGG + Intergenic
911580213 1:99625423-99625445 CATTATGCAAAAACAGAACAGGG + Intergenic
911811975 1:102294828-102294850 CAATATGCAAATCAAGAAATGGG - Intergenic
911972931 1:104460480-104460502 CATTTTCCAAATACAGACCTAGG + Intergenic
912630273 1:111241017-111241039 CATTTTGCAAATGAAGAAATTGG + Intronic
913174235 1:116259320-116259342 CATTATGTATGTAAAGAGTTTGG - Intergenic
914506332 1:148292684-148292706 CATGAAGCAAATTAAGTGCTCGG - Intergenic
916825320 1:168436880-168436902 CAACATGCAAATGAATAGCTGGG + Intergenic
917057371 1:170997766-170997788 CATCATTCAAAGGAAGAGCTTGG + Intronic
918782149 1:188714344-188714366 CATAATACAAACAAAGAGATAGG + Intergenic
920685124 1:208103394-208103416 CCTTATGCAGGTAAAGAGATTGG - Intronic
920867999 1:209769201-209769223 CATTCTGCATAGAAAGAGTTTGG + Intronic
921636688 1:217503928-217503950 CATTCTGCAAATAAAGAAACAGG + Intronic
921839333 1:219811692-219811714 CATTTTTCAAATAAACAGCTGGG + Intronic
921984830 1:221301267-221301289 CAATATACAAATAAAGGACTAGG + Intergenic
922001880 1:221487100-221487122 AAGTAGCCAAATAAAGAGCTGGG - Intergenic
922093495 1:222420587-222420609 CCTTCTTCAAAGAAAGAGCTAGG + Intergenic
924137395 1:240983778-240983800 CATTCATCAAATAAACAGCTGGG - Intronic
924538274 1:244957155-244957177 CAATTTGCAAATAAAGAGAAGGG - Intergenic
1063020940 10:2127093-2127115 CATTATGCAAACAGAGAGGGTGG - Intergenic
1064110152 10:12531613-12531635 CATTTTGCACAGAAAGAGCGTGG + Intronic
1064534502 10:16344831-16344853 CATTATCCAAATAAAGTATTTGG - Intergenic
1064792887 10:18978898-18978920 CATTATTCAAATAAGGCACTAGG - Intergenic
1065036686 10:21646423-21646445 CATGATGAAAATCAAGAGCAAGG - Intronic
1065043832 10:21726849-21726871 AATTATGCAAATAAAGGTTTAGG - Intronic
1065290950 10:24228823-24228845 CATTGTACAGATAAAGTGCTAGG - Intronic
1067533303 10:47090258-47090280 CAATATGTAAATAAATAGGTGGG - Intergenic
1068327681 10:55515734-55515756 CATCATGCAAATCAAGAAATTGG + Intronic
1070444504 10:76482904-76482926 CATTATGCCAAAAATGAGCAAGG - Intronic
1070715969 10:78721204-78721226 CAATATGCAAATTTATAGCTTGG + Intergenic
1071063420 10:81601277-81601299 TATTATGCAAATATAAAGCAAGG + Intergenic
1071829749 10:89360003-89360025 CATTTTGCAAATGAAGAATTTGG + Intronic
1072489483 10:95889616-95889638 GATTATTCAAGTAAAAAGCTGGG + Intronic
1073045213 10:100633636-100633658 CATTTTGCAAATGAAGAAATTGG + Intergenic
1074345526 10:112682075-112682097 AATTATCCATATAAATAGCTTGG - Intronic
1075305301 10:121362489-121362511 AATTATGTAAATCAAGAACTTGG - Intergenic
1075516047 10:123109166-123109188 CATTACCCAAATACAGAGCTGGG + Intergenic
1078723301 11:13903803-13903825 CATCATGCAAATAAAATGCTTGG + Intergenic
1079120287 11:17678634-17678656 CGATATGCTTATAAAGAGCTCGG + Intergenic
1079736759 11:24007064-24007086 CATTATCCAAACAAATAGCTTGG + Intergenic
1080089485 11:28328123-28328145 CATTTTCCTAATAAAGAGTTTGG - Intronic
1080380695 11:31769282-31769304 CATTATGCAAGCAAAGACATTGG + Intronic
1083018750 11:59484246-59484268 CATTATGCAAAAAATTAACTTGG + Intergenic
1086016743 11:82177196-82177218 CATTTTACAAATAAAGAAATTGG - Intergenic
1086114973 11:83239588-83239610 CCATATGCAAAAAAAGAACTTGG - Intronic
1087950967 11:104219836-104219858 CATTATACAAATAAAGAAACTGG + Intergenic
1088039787 11:105365497-105365519 CATTATGCAAGTAGAGAGATTGG - Intergenic
1089364972 11:117915896-117915918 CATAATGCACATAAAGGCCTCGG - Intronic
1089793529 11:120961894-120961916 CATCATGCAAACACAGAGTTTGG + Intronic
1091419827 12:327086-327108 CATAATGCAAAGAAAGGGCAGGG + Intronic
1091898796 12:4126171-4126193 AATTATGAAAATGAAGAGATTGG - Intergenic
1097960129 12:65524204-65524226 AAATATGCAAGCAAAGAGCTGGG + Intergenic
1098379949 12:69858006-69858028 CCTTAAGCAAATAAAGGGCATGG - Intronic
1099313334 12:81054853-81054875 GATAATGCATATAAAGTGCTTGG - Intronic
1099676336 12:85765334-85765356 CTTTTTGCAAATAAAGAGTGAGG + Intergenic
1099943595 12:89219295-89219317 GATTTTGCAAATAAAGAATTTGG + Intergenic
1100009182 12:89933484-89933506 CAGTATAAAAATAAAGAGCTCGG + Intergenic
1101436887 12:104671784-104671806 CATTATGCAAGAAGAGGGCTGGG - Intronic
1102869593 12:116403113-116403135 GATCATGCACATAAAGAGCCTGG + Intergenic
1104591507 12:130087733-130087755 CATCATGCACTTAAAGAGCCTGG - Intergenic
1105953384 13:25255126-25255148 CACTATGAAAATAATGTGCTTGG - Intronic
1106216887 13:27709933-27709955 CATTAAGCAAACAAGGAGCTGGG - Intergenic
1107946510 13:45421565-45421587 CAATATGGAAATGAAGACCTAGG + Intergenic
1108072655 13:46644296-46644318 AATGGTGCAAATAAAGAGCTAGG - Intronic
1108250069 13:48556589-48556611 CATTAAGCAAAAAAAAAACTGGG - Intergenic
1108501113 13:51070840-51070862 CATAATGCACATAAAGCCCTTGG - Intergenic
1108533145 13:51346151-51346173 TATTAAACAAATAAACAGCTGGG + Intronic
1108725647 13:53177630-53177652 CATGATGAAAATAAAAAGCAAGG + Intergenic
1109501776 13:63246514-63246536 CATTATACGAATAAAAAGCCTGG + Intergenic
1109599428 13:64605266-64605288 TATTATGCAAATACATGGCTAGG - Intergenic
1112523508 13:100120382-100120404 CATCCTTCAAATGAAGAGCTTGG - Intronic
1113119665 13:106912708-106912730 CATTTTACAAAAAAAGAGGTAGG + Intergenic
1113257244 13:108519735-108519757 CATTATGCAAAAATAATGCTAGG + Intergenic
1113544645 13:111138826-111138848 CATCATGTAGAGAAAGAGCTGGG + Intronic
1114560069 14:23583344-23583366 CATTAAGCAAATTAACTGCTGGG - Intergenic
1115734458 14:36309511-36309533 CATTATGCAATTAAAGAATACGG + Intronic
1116048376 14:39773226-39773248 CTTTATGCAAACAAACATCTGGG + Intergenic
1117567290 14:57007316-57007338 CAATAAGTAAATAAAGAGCCAGG + Intergenic
1120265471 14:82243877-82243899 CAGTATACAAATAAAGTGCGAGG - Intergenic
1120547328 14:85827993-85828015 CATGATGGAAAGAAAGATCTGGG - Intergenic
1120642319 14:87029962-87029984 CATTATCCTAATAATGAGGTAGG + Intergenic
1121734067 14:96205748-96205770 CTTTATGCAAAGATAGAGGTAGG + Intronic
1127621947 15:60742744-60742766 CATTAGTGAAATAATGAGCTAGG - Intronic
1128737951 15:70064103-70064125 CATTTGTCAAATGAAGAGCTTGG - Intronic
1129954876 15:79627274-79627296 CACTATGCATATAGTGAGCTGGG - Intergenic
1130134212 15:81168400-81168422 CAGTATGCAAATGATGAGCTTGG - Intronic
1130306075 15:82712874-82712896 CCATATGCAAATGAAGAGCCAGG + Intergenic
1130866957 15:87941384-87941406 GATAATCCATATAAAGAGCTTGG + Intronic
1131056239 15:89377072-89377094 AAATATGCAAATAAAGTGCCTGG + Intergenic
1131081445 15:89539786-89539808 CAATAAAAAAATAAAGAGCTAGG + Intergenic
1131349855 15:91689720-91689742 GAATATGCAAAGGAAGAGCTGGG - Intergenic
1131542441 15:93286510-93286532 CATTATGCAGATGAACAGATAGG + Intergenic
1131974037 15:97924154-97924176 CACTCTGCAAAAAAAGATCTGGG + Intergenic
1134383936 16:13754376-13754398 CAGAATACAAATAAATAGCTTGG - Intergenic
1134889686 16:17829159-17829181 AATTATGATAATAAAGTGCTGGG + Intergenic
1135999720 16:27282778-27282800 TCTGTTGCAAATAAAGAGCTTGG + Intronic
1138233766 16:55361872-55361894 CATTATGGAGATAAAGAGACAGG + Intergenic
1138919292 16:61507572-61507594 CATTATGTAAATTAAAAGGTGGG - Intergenic
1138957064 16:61984211-61984233 CCTTATTAAAATAAAGAGTTGGG - Intronic
1139213744 16:65107256-65107278 AAATATGCAAATCAAGACCTAGG - Intronic
1139828133 16:69773784-69773806 AATTATGCAAATGAAAAACTGGG - Intronic
1140282734 16:73569332-73569354 CATTTTGAAAATAAAAAGCCTGG + Intergenic
1140959370 16:79897432-79897454 AATTATGCAAATAAAGAAGCTGG - Intergenic
1203012563 16_KI270728v1_random:311642-311664 CATTATGCAAATGGAGATTTGGG + Intergenic
1203030898 16_KI270728v1_random:584801-584823 CATTATGCAAATGGAGATTTGGG + Intergenic
1203040823 16_KI270728v1_random:749630-749652 CATTATGCAAATGGAGATTTGGG - Intergenic
1143809457 17:9459269-9459291 AATTATTAAAATAAAGAGCCTGG + Intronic
1146457653 17:33019953-33019975 CTTTATGGAAATAAAGGGCAAGG + Intronic
1149007095 17:51817463-51817485 CTTTATGCAGATAAAAAGCCTGG + Intronic
1149820277 17:59769992-59770014 TATTATGCAAATAAATAACAAGG - Intronic
1151351927 17:73536917-73536939 CATTATGTAAGTAAAGTGCAGGG - Intronic
1152191963 17:78893752-78893774 CATTATAAAAGGAAAGAGCTGGG - Intronic
1153248958 18:3101332-3101354 CACTATGAAAATACAAAGCTTGG + Intronic
1158322406 18:56278085-56278107 CATTACACAAATTCAGAGCTAGG + Intergenic
1159055671 18:63461264-63461286 AATAATACAAATAAAGTGCTCGG - Intergenic
1164437098 19:28240084-28240106 CATTATGAAAATCAGGAACTTGG - Intergenic
925576393 2:5364748-5364770 CATTAGGAAAATAAAGATCCAGG + Intergenic
925688155 2:6493882-6493904 CATTTGGTAAATAAAGAACTGGG + Intergenic
925716857 2:6791959-6791981 GATTCTGCAAATAAAGTGCAGGG + Intergenic
926320283 2:11744557-11744579 CATTCTGAAAATGATGAGCTGGG - Intronic
926497248 2:13605364-13605386 CCTTATAAAAATAAAGAGCCTGG - Intergenic
926863259 2:17331512-17331534 CATTGTGCAAATGAAATGCTAGG + Intergenic
928595533 2:32855947-32855969 CATTATGCAAATAAGCAGCCTGG - Intergenic
929175641 2:38972612-38972634 CATTATTCAAAGAAAGAAGTTGG - Intronic
929709359 2:44250549-44250571 CATTATGCAAATAGAAAACCAGG + Intergenic
930531344 2:52592249-52592271 TATTGTGCAAAAACAGAGCTGGG - Intergenic
931713559 2:65010439-65010461 AATTCTGCAAATAAAGGGGTAGG - Intronic
931875777 2:66510280-66510302 GGTTATGCAAATAAAGAGTTTGG + Intronic
931944925 2:67295707-67295729 AATTATGCAAATAAAGAAAATGG + Intergenic
932106753 2:68950554-68950576 AATAATGGAAATAATGAGCTTGG - Intronic
933087213 2:78069605-78069627 CAATATGTAAATAATGAGCATGG + Intergenic
934662563 2:96150905-96150927 CCATATGCAAATGAAGAACTGGG + Intergenic
935245878 2:101218636-101218658 ACTTGTCCAAATAAAGAGCTTGG - Intronic
935586247 2:104802410-104802432 CATTTTACACATAAAGAGATGGG - Intergenic
939515382 2:143160876-143160898 CATACTTCAAAGAAAGAGCTAGG + Intronic
940007103 2:149017918-149017940 TTTTCTGAAAATAAAGAGCTAGG + Intronic
940102367 2:150056027-150056049 CATAATGCAAATAAAAAGCTGGG - Intergenic
941178014 2:162223402-162223424 TATTAGTCAAATAAAGAGGTGGG + Intronic
941245363 2:163089421-163089443 CATGATGAAAATAAATTGCTTGG + Intergenic
941367246 2:164622747-164622769 CATTAGGAAAATAAAGAACTTGG - Intergenic
941441953 2:165549426-165549448 AATTAGGCAGATATAGAGCTTGG + Intronic
941494873 2:166187220-166187242 AATTAAAAAAATAAAGAGCTAGG + Intergenic
942006326 2:171703647-171703669 CATTATGAAGAGAAAGAGCAAGG + Intronic
942073039 2:172332463-172332485 CTTGATTCAAATAAAGAGATTGG + Intergenic
943539339 2:189192457-189192479 CATTATGCAAATAAGGAATTGGG - Intergenic
943610151 2:190022703-190022725 TATTATGTAAATAAAGTGCCAGG + Intronic
945872254 2:215240327-215240349 CATTTGGGAAATAAAGATCTAGG - Intergenic
947328604 2:229004558-229004580 TAGTATGAAAATAAAGAGCTGGG + Intronic
1169015437 20:2289144-2289166 CATTAGTCAAATGAAGAGGTTGG + Intergenic
1169703742 20:8478904-8478926 CATTATACATGTAAAAAGCTTGG + Intronic
1170558325 20:17533574-17533596 CATGATGCAAACAAAGGCCTGGG - Intronic
1171002717 20:21430821-21430843 CTTTTTGAAAATAGAGAGCTTGG + Intergenic
1171361127 20:24586933-24586955 CATTATAATAATAAAGAGCAAGG + Intronic
1173703312 20:45092314-45092336 CATTATGCAAATAAAGAGCTGGG - Exonic
1175765004 20:61586362-61586384 GTTAATGCACATAAAGAGCTTGG - Intronic
1176347225 21:5760259-5760281 ATTTATAAAAATAAAGAGCTGGG + Intergenic
1176354039 21:5880843-5880865 ATTTATAAAAATAAAGAGCTGGG + Intergenic
1176497602 21:7564196-7564218 ATTTATAAAAATAAAGAGCTGGG - Intergenic
1176541546 21:8158329-8158351 ATTTATAAAAATAAAGAGCTGGG + Intergenic
1176560497 21:8341374-8341396 ATTTATAAAAATAAAGAGCTGGG + Intergenic
1176903524 21:14472801-14472823 TATGATACAAATAATGAGCTGGG + Intergenic
1177531433 21:22363343-22363365 CATTATGCTAATAAAGCATTTGG - Intergenic
1178527198 21:33341237-33341259 CATCATGCAAATGAATGGCTTGG - Intronic
1181943150 22:26494586-26494608 GATAAAGCAAATAAAGTGCTTGG + Exonic
1182065847 22:27431170-27431192 CATTTTGCAAATGAAGAGCTTGG - Intergenic
1182086728 22:27566061-27566083 CATTATGCATATAAAGAGACTGG + Intergenic
1182699211 22:32220386-32220408 CATTAGGTAAACAAAGAGCCAGG + Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
1203246485 22_KI270733v1_random:74748-74770 ATTTATAAAAATAAAGAGCTGGG + Intergenic
950619924 3:14196703-14196725 GATTTTGCAAATAAAGATGTAGG - Intronic
950756421 3:15176999-15177021 AATTGTGCAAGTAAAGTGCTTGG - Intergenic
951105920 3:18742610-18742632 CATTAGCTAAATAAAGAGCATGG - Intergenic
951267141 3:20581416-20581438 CATTATGCAGATCAATAGCATGG - Intergenic
951834056 3:26961585-26961607 CAATATGCAAATTAAGAGATAGG + Intergenic
951975357 3:28501229-28501251 CATTGTGCAAAAAATGAGATTGG + Intronic
951997244 3:28744732-28744754 CATTCTTCAGATATAGAGCTAGG + Intergenic
952705240 3:36370594-36370616 CCTTAGACAATTAAAGAGCTAGG + Intergenic
953657270 3:44863606-44863628 CATTTTACAGATAAAGAGCCAGG - Intronic
957363216 3:79186018-79186040 CATCATTAAAATAAAGGGCTTGG - Intronic
957683151 3:83465525-83465547 CATTATTCAACTACAGAGTTGGG + Intergenic
959425530 3:106182978-106183000 CATTATGCATATTAAGGGTTTGG - Intergenic
959611584 3:108300836-108300858 CATTATTAAAATAAAGTGTTTGG - Intronic
959871490 3:111333332-111333354 GATTATGCAAATAAAAAGAGAGG + Intronic
960749393 3:120930020-120930042 CAAGATGCAAATAATGAACTGGG - Intronic
961555133 3:127691970-127691992 CTTTATGCAAAAAAAGAGAAAGG - Exonic
963229368 3:142894137-142894159 CAATATATAAATAAAAAGCTGGG + Intergenic
964585815 3:158300190-158300212 CATTTTGGGAATAAAGAGCCAGG + Intronic
965638858 3:170812182-170812204 AATTAGGCAAACAAAAAGCTGGG - Intronic
966748383 3:183299656-183299678 CACTCTGCAAATATAGTGCTTGG + Intronic
967327606 3:188257795-188257817 CACTTTGCAAATAAGGAACTGGG + Intronic
967863831 3:194174118-194174140 CATTTGGAAAATAAAGAGGTTGG - Intergenic
967932764 3:194702493-194702515 CCGTATGCAAACAAAGTGCTGGG + Intergenic
968141059 3:196257253-196257275 AAGCATGCAAATAAAGAGCAAGG + Intronic
968781760 4:2587721-2587743 AATTTTGAAAAGAAAGAGCTGGG + Intronic
969241914 4:5904535-5904557 CATTTTACAGATAAGGAGCTGGG + Intronic
970084093 4:12325748-12325770 CATTATGGAAATAAAGTTTTAGG + Intergenic
971647084 4:29220393-29220415 TAATATTCAAATAAAGAGTTTGG - Intergenic
972273590 4:37535995-37536017 GATCATGCACATAAAGTGCTTGG + Intronic
973191766 4:47393517-47393539 CAGTATGCAAAGAAAAAACTGGG - Intronic
973329875 4:48902337-48902359 CATCATGCATGTAAAGTGCTTGG - Intronic
973872936 4:55184933-55184955 GATAATGCAAATAGAGACCTTGG - Intergenic
976365076 4:84224019-84224041 CATCATGCAAATTAACAGCAAGG - Intergenic
976454884 4:85234694-85234716 CATGATGGCAATAAAGGGCTAGG + Intergenic
976751269 4:88453156-88453178 CCTTATGCAAATGAAGGGCCTGG - Intergenic
977311250 4:95390565-95390587 CATTATGGAAATAAGGAAATAGG - Intronic
977340976 4:95757237-95757259 CAATTTGCATATAAATAGCTAGG + Intergenic
977796650 4:101173758-101173780 CATTAAGAAAAAAAAGAGCATGG + Intronic
979066403 4:116140904-116140926 GATAATTCAGATAAAGAGCTAGG - Intergenic
983898800 4:173110779-173110801 CATAATACAAATAAAAAGGTAGG + Intergenic
988189188 5:27905766-27905788 CATTATGAAAATAGAGAGATAGG - Intergenic
988407507 5:30842314-30842336 AATTTTGCAGATAAAGAACTGGG + Intergenic
989667017 5:43866470-43866492 CATTAAGGAAATAAATAGTTTGG + Intergenic
989986388 5:50703667-50703689 CATTATACAACTGAAGAGCCTGG - Intronic
990803380 5:59631130-59631152 CATAATGCAAATAAAGTTATTGG - Intronic
993497979 5:88629366-88629388 GAGTATGCAAATAAAAACCTCGG + Intergenic
993976050 5:94482408-94482430 TATTTTGCTAATAAAGATCTTGG - Intronic
994401970 5:99291709-99291731 CATTTTGCAGATAAAGAGAAAGG - Intergenic
994740581 5:103612749-103612771 ATTTATGCAAATAAAAAGCTGGG + Intergenic
995266437 5:110167014-110167036 CTTTATCCTAATCAAGAGCTTGG + Intergenic
995810111 5:116097158-116097180 AAATATGCAAATAAAGAAGTTGG + Intronic
996413132 5:123180575-123180597 CATCATTAAAATAAAGAGGTAGG + Intronic
996723859 5:126656553-126656575 TATTAGGCAAATAATGAACTTGG - Intergenic
996891441 5:128425970-128425992 CTTTATGCATATACACAGCTAGG - Intronic
999040940 5:148411169-148411191 TATTATGGAAATGAAGAGCATGG - Intronic
999829254 5:155303448-155303470 CATTGGTCAAAAAAAGAGCTGGG + Intergenic
1003076074 6:2984858-2984880 CAAAATGCAAATTAAGAGCCAGG + Intergenic
1003621119 6:7701127-7701149 CATTATACACATAAAGATATAGG - Intergenic
1004084102 6:12427306-12427328 CATGAAGCAAAGAAAGAGCTTGG - Intergenic
1004098938 6:12588333-12588355 GATTATGTAAATAAATACCTGGG + Intergenic
1005099688 6:22157399-22157421 CATTTTGCAGATAAGGAGATTGG + Intergenic
1005401894 6:25443209-25443231 TATTATGCAAAGAAACAGCAAGG - Intronic
1006911068 6:37564014-37564036 CATCAGGAAAATAAAGATCTTGG - Intergenic
1009260332 6:61478446-61478468 CATTCTGCAAATAAACATTTGGG + Intergenic
1010354905 6:74921481-74921503 GATTTTGCAAATAAATAGCATGG + Intergenic
1010892072 6:81325457-81325479 CCTTATGCAAAGCAAGGGCTGGG - Intergenic
1012955815 6:105568824-105568846 CATTTTATAAATAAAGAGCTGGG - Intergenic
1014382832 6:120765075-120765097 CATTATGTAAACAAACAGTTTGG + Intergenic
1014885569 6:126776639-126776661 CTTTATGAAAATAAAGAAGTGGG + Intergenic
1016198958 6:141384216-141384238 AACTATGCAAATAATGAACTAGG + Intergenic
1017345829 6:153379673-153379695 CATTAGGCAATCACAGAGCTGGG + Intergenic
1017489575 6:154933220-154933242 TTTTATGCAAGAAAAGAGCTGGG + Intronic
1017858458 6:158372899-158372921 CGTTAGGCATATAAAGAACTAGG + Intronic
1018453402 6:163930062-163930084 AATTATGAACATAAAGAGCCTGG - Intergenic
1018506788 6:164480007-164480029 CATGATTACAATAAAGAGCTTGG - Intergenic
1018646770 6:165956203-165956225 CATTATGCAAATCTAGAGCCTGG + Intronic
1019344638 7:523216-523238 AATTATACAAGGAAAGAGCTTGG - Intergenic
1019833806 7:3360406-3360428 CATTATGCAAATGTAGCTCTGGG + Intronic
1019834495 7:3368893-3368915 TATTATATAAATAAAGAGCAAGG + Intronic
1020664472 7:11023037-11023059 CATAATACAAATAAAAAGCCAGG - Intronic
1020672719 7:11137936-11137958 CTTTATACAAGGAAAGAGCTAGG - Intronic
1020721914 7:11756092-11756114 CATTCTGCAAATAAAGAAACTGG - Intronic
1021200939 7:17728121-17728143 CATTAGGGAAATAAATAGCCAGG + Intergenic
1021258442 7:18423704-18423726 CATTCTCCATGTAAAGAGCTTGG - Intronic
1021477680 7:21080867-21080889 CATTATGACAATGAAGAGGTGGG - Intergenic
1022022626 7:26415532-26415554 TTATATGCAAATAAAGAACTGGG + Intergenic
1023941843 7:44773366-44773388 CTTTATTAAAATAAAGAGTTGGG - Intergenic
1024731561 7:52259126-52259148 CATTATGGAAAATAAAAGCTGGG - Intergenic
1024930503 7:54663378-54663400 CATTCTGCAAATGAAGATCCAGG + Intergenic
1027298368 7:76802493-76802515 CACTCTGAAAATAAAGAGGTAGG - Intergenic
1027846719 7:83387248-83387270 CATTATGTAAATAAAGAACAGGG - Intronic
1028517571 7:91695575-91695597 GATTATGTACATAAAGTGCTTGG - Intronic
1031091834 7:117366490-117366512 TATTAAACAGATAAAGAGCTCGG + Intronic
1031495397 7:122441237-122441259 CATGAGGGAAATAAAGAGGTAGG + Intronic
1038929900 8:32182114-32182136 CATTATGAAAAAGAGGAGCTGGG + Intronic
1042193953 8:66215943-66215965 CATTATGCAATTTGACAGCTAGG - Intergenic
1042809206 8:72805543-72805565 CCTGCTGCAAATAAAGATCTTGG + Intronic
1044466808 8:92516207-92516229 CATTAAGCAAAGAAACAGCGGGG + Intergenic
1044800412 8:95948224-95948246 CATGATGCATTTCAAGAGCTAGG + Intergenic
1045451505 8:102331417-102331439 CATTAAGCAAATCTAGAGCTAGG - Intronic
1046106387 8:109672207-109672229 CATTATGTAATTTAAAAGCTGGG + Intronic
1047067742 8:121305245-121305267 TATAATGAAAATAAAGAGATGGG + Intergenic
1047797010 8:128267869-128267891 CATTATGCAAATGAGCAGCAGGG - Intergenic
1047827287 8:128590902-128590924 GATAATGCACATAAAGTGCTTGG + Intergenic
1048546446 8:135391823-135391845 CATTATACAAATGAAGAAATTGG - Intergenic
1048778462 8:137974228-137974250 TAAGATGCAAAGAAAGAGCTTGG - Intergenic
1048793990 8:138131522-138131544 CCTTAGGAAAATAAAGGGCTAGG - Exonic
1050276488 9:4006574-4006596 CTTAATGCATATAAAGGGCTAGG - Intronic
1052061704 9:23967441-23967463 AATCAAGAAAATAAAGAGCTGGG - Intergenic
1052380287 9:27763499-27763521 CAGTAGGCAAAAGAAGAGCTCGG + Intergenic
1053377974 9:37624308-37624330 CATAATGCAATTACAGAGGTGGG + Intronic
1055419850 9:76127787-76127809 GGTAATGGAAATAAAGAGCTTGG - Intronic
1055488554 9:76781176-76781198 AACAATGCAAATAAAGAGATGGG - Intronic
1057050372 9:91919050-91919072 CATGATGCAAATAAAATCCTAGG - Intronic
1058117002 9:101095741-101095763 CAATATGCAGAGAAAGAGCTTGG - Intronic
1058370468 9:104260306-104260328 CATTAAGCTAATTAACAGCTTGG - Intergenic
1059903922 9:118960564-118960586 CATTATGCAAAGAAAAAGAGAGG - Intergenic
1060214396 9:121729982-121730004 CATTCTGCAGATAAGGAGCCTGG + Intronic
1203462820 Un_GL000220v1:57820-57842 ATTTATAAAAATAAAGAGCTGGG + Intergenic
1186284658 X:8030496-8030518 CATTATACAAATAAAGATTATGG + Intergenic
1187986824 X:24822764-24822786 TATTATGCAAATAAAGATTTTGG + Intronic
1188100831 X:26081789-26081811 CATAAAGCTAATAAACAGCTAGG + Intergenic
1189020185 X:37328124-37328146 CATTATGAAAGTTAAGATCTTGG + Intergenic
1191260665 X:58316515-58316537 CAATCTGCAAATAAACAGCTGGG + Intergenic
1195920101 X:109975196-109975218 CTCAATGCACATAAAGAGCTTGG - Intergenic
1197252125 X:124227364-124227386 AATTATACAAAAAAATAGCTGGG - Intronic
1197300515 X:124774616-124774638 AATTATGCACATAAATAGATTGG - Intronic
1198380893 X:136082386-136082408 AATTATGCAAAAATAGAGATGGG + Intergenic
1198528398 X:137525110-137525132 CAGCATGAAAAGAAAGAGCTTGG + Intergenic
1199531795 X:148856372-148856394 CATTTTACAAATGAAGAACTGGG + Intronic
1200243126 X:154508093-154508115 CATGATGGCAATAAAGAACTAGG - Intronic
1200948689 Y:8870663-8870685 CATTTTCCAAATAAAGACCCAGG - Intergenic