ID: 1173704637

View in Genome Browser
Species Human (GRCh38)
Location 20:45100903-45100925
Sequence CACAGGTAAGGGGCCTCCTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173704637_1173704644 -8 Left 1173704637 20:45100903-45100925 CCAAAGGAGGCCCCTTACCTGTG 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1173704644 20:45100918-45100940 TACCTGTGGTGGCACCTCCCGGG 0: 1
1: 0
2: 0
3: 25
4: 230
1173704637_1173704650 24 Left 1173704637 20:45100903-45100925 CCAAAGGAGGCCCCTTACCTGTG 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1173704650 20:45100950-45100972 TGTCTGTCCCAAAGCCACCGAGG 0: 1
1: 0
2: 0
3: 11
4: 115
1173704637_1173704652 29 Left 1173704637 20:45100903-45100925 CCAAAGGAGGCCCCTTACCTGTG 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1173704652 20:45100955-45100977 GTCCCAAAGCCACCGAGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 131
1173704637_1173704643 -9 Left 1173704637 20:45100903-45100925 CCAAAGGAGGCCCCTTACCTGTG 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1173704643 20:45100917-45100939 TTACCTGTGGTGGCACCTCCCGG 0: 1
1: 0
2: 1
3: 7
4: 140
1173704637_1173704651 28 Left 1173704637 20:45100903-45100925 CCAAAGGAGGCCCCTTACCTGTG 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1173704651 20:45100954-45100976 TGTCCCAAAGCCACCGAGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173704637 Original CRISPR CACAGGTAAGGGGCCTCCTT TGG (reversed) Exonic