ID: 1173704722

View in Genome Browser
Species Human (GRCh38)
Location 20:45101208-45101230
Sequence AGGGGCATCCTCCGGAGTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173704711_1173704722 25 Left 1173704711 20:45101160-45101182 CCTGACTCGGCTGGGGGGTGGTG 0: 1
1: 0
2: 1
3: 16
4: 221
Right 1173704722 20:45101208-45101230 AGGGGCATCCTCCGGAGTTACGG 0: 1
1: 0
2: 0
3: 6
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173704722 Original CRISPR AGGGGCATCCTCCGGAGTTA CGG Intergenic
910216238 1:84847738-84847760 AGATGCATCCTCTGGAGTGATGG - Intronic
919858775 1:201724560-201724582 AAGGGCACCCTCTGGAGTTGTGG - Intronic
1064113932 10:12561562-12561584 AGGGGAAGTCTCCGGACTTAGGG - Intronic
1067945856 10:50687492-50687514 AGGGCCATCCTCAGGAGATAAGG + Intergenic
1070867371 10:79714367-79714389 AGGGCCATCCTCAAGAGATAAGG + Intronic
1070881163 10:79852491-79852513 AGGGCCATCCTCAAGAGATAAGG + Intergenic
1071634286 10:87236590-87236612 ACGGCCATCCTCAGGAGATAAGG + Intronic
1071647736 10:87368807-87368829 ACGGCCATCCTCAGGAGATAAGG + Intronic
1073378324 10:103056475-103056497 AGGGGCATCCCCCGCACTCAAGG + Intronic
1082855823 11:57805744-57805766 AGAGGCATCCTGAGAAGTTATGG + Intronic
1091563164 12:1629823-1629845 AGGGGCATCCTCCAGAGGAGGGG + Intronic
1099977356 12:89559831-89559853 AGGGGCATCTGCAGGAGGTAAGG + Intergenic
1111213319 13:85109013-85109035 AGGGGCAGCTTCCTGACTTAAGG - Intergenic
1115758741 14:36556720-36556742 AGGGGCTTCCTCCTGAGTAGAGG + Intergenic
1129191343 15:73939353-73939375 AGGAGCAGCCTCAGGAGTTCAGG - Intronic
1137327672 16:47458420-47458442 AGGGGCAGCTTCCAGAGTCATGG - Intronic
1137825552 16:51491455-51491477 AGGGGCATCTTTCGGACCTAAGG + Intergenic
1147652887 17:42072234-42072256 AGGACCATTCTCCGGAGATAGGG - Intergenic
1153791911 18:8586568-8586590 AGAAGCATCCCCCCGAGTTAGGG + Intergenic
1155850320 18:30766513-30766535 AGGTGCATACTCCTAAGTTAGGG + Intergenic
1158107772 18:53904959-53904981 AGAGGCATCTTCTGGAGTTTTGG - Intergenic
928835911 2:35544769-35544791 AGAGGCATCCTCCGAAGTGAAGG - Intergenic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
936462400 2:112722924-112722946 AGGGGCATCACCCAGAGCTAAGG - Intronic
937033598 2:118762316-118762338 AGGGGCTTCCACCTGAGTTGTGG + Intergenic
943359620 2:186901810-186901832 AGGGGCATCCTCCATTGCTAAGG - Intergenic
945632371 2:212296629-212296651 AGGGTCAGCCTGCAGAGTTATGG - Intronic
948332597 2:237182000-237182022 AGGGGAAGCCTTGGGAGTTAGGG + Intergenic
948887655 2:240892188-240892210 AGGGCCATCGTCAGGAGGTAGGG - Intronic
1170935988 20:20810138-20810160 AGGTGCATACTCCTAAGTTAGGG - Intergenic
1173704722 20:45101208-45101230 AGGGGCATCCTCCGGAGTTACGG + Intergenic
1180050648 21:45329575-45329597 AGGGGCACCCTCCGGGGCCACGG - Intergenic
1183670506 22:39269864-39269886 AGGGGCTCCCTCTGGAGTTAGGG - Intergenic
1183670514 22:39269889-39269911 AGGGGCTCCCTCTGGAGTTAGGG - Intergenic
1183702603 22:39458335-39458357 AGGGGCATCTTCCGGGGCTGGGG - Intronic
952379443 3:32793149-32793171 AGGGGCATCACCAGGAGTTCTGG + Intergenic
956687236 3:71841358-71841380 AGGCGCATACTCCTAAGTTAGGG + Intergenic
971437259 4:26640847-26640869 AGGGGCATCCGCCATAGTTGAGG + Intronic
974146902 4:57960137-57960159 AGGAGCATCCTGCTGAGTTATGG + Intergenic
979538970 4:121857513-121857535 AGAGGCAACCTCTGGAGTAATGG + Intronic
985495081 5:199682-199704 TGGGGCCTCCTCGGGAGGTAGGG - Exonic
995504380 5:112843765-112843787 AGGGGCATCCACCTGAATAAAGG - Exonic
1004246438 6:13981952-13981974 AGGGTCATCCTACAGTGTTATGG + Intergenic
1005968613 6:30744062-30744084 AGGGGCGTCCTCTGGAGGCAGGG + Exonic
1010085573 6:71913801-71913823 AGGGGTGTCCTCAGGAGTTGAGG - Intronic
1026644275 7:72154243-72154265 AGGGGCATACTACGGGATTATGG + Intronic
1036623709 8:10446707-10446729 AGGTGCATACTCCTAAGTTAGGG + Intergenic
1036697697 8:10988836-10988858 AGAGGCCTGCTGCGGAGTTAAGG + Intronic
1046006202 8:108488688-108488710 AGGTGCAACCTCTGGAGTTGGGG - Intergenic
1052782271 9:32793789-32793811 AGTTGCATCCTCTGGAGTGAAGG - Intergenic
1057353082 9:94316570-94316592 AGGGCCATCCTCAGGAGACAAGG - Intergenic
1057654663 9:96941021-96941043 AGGGCCATCCTCAGGAGACAAGG + Intronic
1058815596 9:108680228-108680250 AGGTGCAGCCTCCCTAGTTACGG - Intergenic
1060052779 9:120388975-120388997 AGGGGCAGGCACCGGAGTTGAGG - Exonic
1060794489 9:126504790-126504812 AGGGGCATCCTCGGGTCTCAGGG - Exonic
1186873885 X:13798294-13798316 AGAGGCATCCTCTGGACTGAGGG + Intronic
1195020601 X:100823337-100823359 AGGGGCATCCTCAGGACTGATGG - Exonic
1200153311 X:153962112-153962134 AGAGGCATCCTCAGGCCTTAGGG + Intronic