ID: 1173705158

View in Genome Browser
Species Human (GRCh38)
Location 20:45104799-45104821
Sequence CAGGGTAAAGAAAGGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173705158_1173705165 8 Left 1173705158 20:45104799-45104821 CCTCCTGCCCTTTCTTTACCCTG No data
Right 1173705165 20:45104830-45104852 TTAGAATTTAACTTAGCTGCGGG No data
1173705158_1173705166 19 Left 1173705158 20:45104799-45104821 CCTCCTGCCCTTTCTTTACCCTG No data
Right 1173705166 20:45104841-45104863 CTTAGCTGCGGGAACAGAAACGG No data
1173705158_1173705164 7 Left 1173705158 20:45104799-45104821 CCTCCTGCCCTTTCTTTACCCTG No data
Right 1173705164 20:45104829-45104851 GTTAGAATTTAACTTAGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173705158 Original CRISPR CAGGGTAAAGAAAGGGCAGG AGG (reversed) Intergenic
No off target data available for this crispr