ID: 1173709112 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:45139010-45139032 |
| Sequence | GATGGTTCCGGGTCAAGTTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1173709112_1173709116 | 0 | Left | 1173709112 | 20:45139010-45139032 | CCTCAACTTGACCCGGAACCATC | No data | ||
| Right | 1173709116 | 20:45139033-45139055 | AGCTGTTTCCTTTCACCTCCAGG | No data | ||||
| 1173709112_1173709120 | 28 | Left | 1173709112 | 20:45139010-45139032 | CCTCAACTTGACCCGGAACCATC | No data | ||
| Right | 1173709120 | 20:45139061-45139083 | ATAACGTGAAACCATTTGTGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1173709112 | Original CRISPR | GATGGTTCCGGGTCAAGTTG AGG (reversed) | Intergenic | ||