ID: 1173709112

View in Genome Browser
Species Human (GRCh38)
Location 20:45139010-45139032
Sequence GATGGTTCCGGGTCAAGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173709112_1173709116 0 Left 1173709112 20:45139010-45139032 CCTCAACTTGACCCGGAACCATC No data
Right 1173709116 20:45139033-45139055 AGCTGTTTCCTTTCACCTCCAGG No data
1173709112_1173709120 28 Left 1173709112 20:45139010-45139032 CCTCAACTTGACCCGGAACCATC No data
Right 1173709120 20:45139061-45139083 ATAACGTGAAACCATTTGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173709112 Original CRISPR GATGGTTCCGGGTCAAGTTG AGG (reversed) Intergenic