ID: 1173709116

View in Genome Browser
Species Human (GRCh38)
Location 20:45139033-45139055
Sequence AGCTGTTTCCTTTCACCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173709112_1173709116 0 Left 1173709112 20:45139010-45139032 CCTCAACTTGACCCGGAACCATC No data
Right 1173709116 20:45139033-45139055 AGCTGTTTCCTTTCACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173709116 Original CRISPR AGCTGTTTCCTTTCACCTCC AGG Intergenic