ID: 1173709120

View in Genome Browser
Species Human (GRCh38)
Location 20:45139061-45139083
Sequence ATAACGTGAAACCATTTGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173709113_1173709120 17 Left 1173709113 20:45139021-45139043 CCCGGAACCATCAGCTGTTTCCT No data
Right 1173709120 20:45139061-45139083 ATAACGTGAAACCATTTGTGCGG No data
1173709114_1173709120 16 Left 1173709114 20:45139022-45139044 CCGGAACCATCAGCTGTTTCCTT No data
Right 1173709120 20:45139061-45139083 ATAACGTGAAACCATTTGTGCGG No data
1173709112_1173709120 28 Left 1173709112 20:45139010-45139032 CCTCAACTTGACCCGGAACCATC No data
Right 1173709120 20:45139061-45139083 ATAACGTGAAACCATTTGTGCGG No data
1173709115_1173709120 10 Left 1173709115 20:45139028-45139050 CCATCAGCTGTTTCCTTTCACCT No data
Right 1173709120 20:45139061-45139083 ATAACGTGAAACCATTTGTGCGG No data
1173709118_1173709120 -10 Left 1173709118 20:45139048-45139070 CCTCCAGGAAGAGATAACGTGAA No data
Right 1173709120 20:45139061-45139083 ATAACGTGAAACCATTTGTGCGG No data
1173709117_1173709120 -3 Left 1173709117 20:45139041-45139063 CCTTTCACCTCCAGGAAGAGATA No data
Right 1173709120 20:45139061-45139083 ATAACGTGAAACCATTTGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173709120 Original CRISPR ATAACGTGAAACCATTTGTG CGG Intergenic