ID: 1173709696

View in Genome Browser
Species Human (GRCh38)
Location 20:45143786-45143808
Sequence AGGGAGAGCTCAGTGCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173709696_1173709703 24 Left 1173709696 20:45143786-45143808 CCCACAAGCACTGAGCTCTCCCT No data
Right 1173709703 20:45143833-45143855 TGTGCCATGCAGCCTCTGCCGGG No data
1173709696_1173709704 25 Left 1173709696 20:45143786-45143808 CCCACAAGCACTGAGCTCTCCCT No data
Right 1173709704 20:45143834-45143856 GTGCCATGCAGCCTCTGCCGGGG No data
1173709696_1173709702 23 Left 1173709696 20:45143786-45143808 CCCACAAGCACTGAGCTCTCCCT No data
Right 1173709702 20:45143832-45143854 CTGTGCCATGCAGCCTCTGCCGG No data
1173709696_1173709705 26 Left 1173709696 20:45143786-45143808 CCCACAAGCACTGAGCTCTCCCT No data
Right 1173709705 20:45143835-45143857 TGCCATGCAGCCTCTGCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173709696 Original CRISPR AGGGAGAGCTCAGTGCTTGT GGG (reversed) Intergenic