ID: 1173712800

View in Genome Browser
Species Human (GRCh38)
Location 20:45175444-45175466
Sequence CTCACTCATTTCTACATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 1, 2: 0, 3: 35, 4: 455}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173712800_1173712805 11 Left 1173712800 20:45175444-45175466 CCAAAAATGTAGAAATGAGTGAG 0: 1
1: 1
2: 0
3: 35
4: 455
Right 1173712805 20:45175478-45175500 GTAATTCCCAGAGCCAGGATGGG 0: 1
1: 0
2: 0
3: 17
4: 250
1173712800_1173712803 6 Left 1173712800 20:45175444-45175466 CCAAAAATGTAGAAATGAGTGAG 0: 1
1: 1
2: 0
3: 35
4: 455
Right 1173712803 20:45175473-45175495 CCAAGGTAATTCCCAGAGCCAGG 0: 1
1: 0
2: 0
3: 19
4: 176
1173712800_1173712806 12 Left 1173712800 20:45175444-45175466 CCAAAAATGTAGAAATGAGTGAG 0: 1
1: 1
2: 0
3: 35
4: 455
Right 1173712806 20:45175479-45175501 TAATTCCCAGAGCCAGGATGGGG 0: 1
1: 0
2: 1
3: 41
4: 275
1173712800_1173712804 10 Left 1173712800 20:45175444-45175466 CCAAAAATGTAGAAATGAGTGAG 0: 1
1: 1
2: 0
3: 35
4: 455
Right 1173712804 20:45175477-45175499 GGTAATTCCCAGAGCCAGGATGG 0: 1
1: 0
2: 2
3: 16
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173712800 Original CRISPR CTCACTCATTTCTACATTTT TGG (reversed) Intronic
900822874 1:4902747-4902769 CAAAGTCATTTCCACATTTTTGG + Intergenic
901431428 1:9217529-9217551 CTGACTAATTTCTGTATTTTTGG + Intergenic
902232586 1:15037110-15037132 CTCTCTCATTTCTCCATTCTCGG + Intronic
903837426 1:26214472-26214494 CTGGCTCATTTCAATATTTTTGG - Intergenic
904534400 1:31189673-31189695 CTGACTCATTTCTAGTTTCTGGG + Intronic
905448352 1:38042174-38042196 CTCCCTCATTTCTCCATTCCTGG - Intergenic
907707897 1:56848411-56848433 CAAAGTCATTTCCACATTTTTGG + Intergenic
907720459 1:56967412-56967434 CTCAGTCATTTGTATCTTTTGGG - Intergenic
907728310 1:57041223-57041245 CTCATTCACTTCTTCATTCTTGG + Intronic
908265882 1:62378762-62378784 CTAACTCATCTCTAAAATTTGGG - Intergenic
908749620 1:67407989-67408011 CTGATTCAGTTCTAGATTTTAGG - Intronic
909271699 1:73629863-73629885 CAAAGTCATTTCCACATTTTGGG + Intergenic
909460229 1:75903747-75903769 GTCACTGATTTTTATATTTTTGG + Intronic
910357680 1:86378424-86378446 CAAAGTCATTTCCACATTTTTGG + Intronic
910381965 1:86636648-86636670 CCAACTCATTTCAACTTTTTTGG + Intergenic
910550624 1:88469964-88469986 CTCACACTATGCTACATTTTTGG + Intergenic
910585565 1:88875544-88875566 CTCACTCACTACTACTGTTTAGG + Intronic
910628784 1:89336340-89336362 CAAAGTCACTTCTACATTTTGGG - Intergenic
911486341 1:98511443-98511465 GTCACGAATTACTACATTTTTGG + Intergenic
911501566 1:98692946-98692968 CTCAGTTTTTTCTACATTTCTGG + Intronic
911812439 1:102300149-102300171 CTTATTCATTTCTAACTTTTTGG - Intergenic
912200414 1:107451429-107451451 CCTTCTCATTTTTACATTTTTGG - Intronic
912858982 1:113196212-113196234 CTCATTCATATTTATATTTTTGG + Intergenic
913523949 1:119673208-119673230 CTTTCTCATTGCTACATTTGCGG + Intronic
915407411 1:155671267-155671289 CTGGCTAATTTTTACATTTTTGG - Intronic
915848794 1:159298696-159298718 CTCTCTCCTTTCTTCTTTTTAGG + Intronic
915976875 1:160397162-160397184 CTCATTCATTTCTATATCTCTGG - Intergenic
916156009 1:161849209-161849231 CTCACTCAATGCTTCATTTTAGG + Intronic
916327595 1:163580662-163580684 CTCACTCAGTTATACATATGAGG + Intergenic
916606625 1:166348997-166349019 TTCCTGCATTTCTACATTTTTGG + Intergenic
918079380 1:181194066-181194088 CAAAGTCATTTCCACATTTTTGG - Intergenic
918191129 1:182175520-182175542 CTCACAGATTTCAACATGTTGGG - Intergenic
918553515 1:185771962-185771984 CTCACGCATTATTTCATTTTTGG - Intronic
918673050 1:187244834-187244856 CTCATTCATGTCAGCATTTTAGG - Intergenic
918800063 1:188960236-188960258 CAAAGTCATTTCCACATTTTCGG - Intergenic
918973915 1:191455843-191455865 CCTTCTCATCTCTACATTTTTGG + Intergenic
921569646 1:216763159-216763181 TTTCCTCAATTCTACATTTTGGG + Intronic
921723442 1:218498849-218498871 CTCACTCTGTTCTTCCTTTTTGG + Intergenic
921966119 1:221091717-221091739 CCCAGCCAGTTCTACATTTTTGG + Intergenic
922908770 1:229197865-229197887 ATCTCTGATTTCTACAATTTGGG + Intergenic
923514658 1:234684737-234684759 TTCATTCATTTATACTTTTTGGG + Intergenic
923943641 1:238858111-238858133 CTCACTCATTCCTTCATGTTTGG - Intergenic
924015678 1:239719145-239719167 CTCACCCATTTCATCATTTCCGG - Intronic
924027969 1:239857147-239857169 CTCACTCATTTCTACCCTCCTGG - Intronic
924046648 1:240038837-240038859 CTCATTCATTTCTTTATTTTAGG - Intronic
924730062 1:246702922-246702944 TTCAATGATTTCTACATTTCAGG + Intergenic
1063547439 10:6995928-6995950 CTCATTCATTTCTACATTCCTGG + Intergenic
1063838139 10:10040039-10040061 CTCCCTCATTTCCAAGTTTTAGG + Intergenic
1064466858 10:15592045-15592067 TTCAGTAATTTCAACATTTTAGG - Intronic
1064469625 10:15622521-15622543 CTTTGTGATTTCTACATTTTTGG - Intronic
1064899444 10:20277780-20277802 CTTACTCATTTTTCTATTTTTGG + Intronic
1065225964 10:23544376-23544398 CACAGTCACTTCCACATTTTCGG - Intergenic
1065447449 10:25817920-25817942 CTGCCTCATTTCTACAGATTGGG + Intergenic
1066228396 10:33407429-33407451 ATCTCTCATTTCTAGATGTTTGG - Intergenic
1070410625 10:76136517-76136539 CTCAATCATTTGCACATATTAGG - Intronic
1070766332 10:79058537-79058559 CTCTCCCATGTCTACAATTTTGG + Intergenic
1071063827 10:81606808-81606830 CTCATTCATCCTTACATTTTGGG + Intergenic
1071244771 10:83750826-83750848 CAAAGTCACTTCTACATTTTTGG - Intergenic
1071809780 10:89166865-89166887 CTCATCCATTGCTACATTCTTGG - Intergenic
1072372999 10:94784749-94784771 CTGACTAATTTTTATATTTTTGG + Intronic
1072769468 10:98125635-98125657 CAAAGTCACTTCTACATTTTTGG + Intergenic
1073549030 10:104380430-104380452 CTCTCTCATTTCTACTTTCCAGG + Intronic
1073864497 10:107786551-107786573 CAAAGTCATTTCCACATTTTTGG - Intergenic
1074368900 10:112882926-112882948 CTCACTCATCTCTTCATTCTTGG + Intergenic
1074555245 10:114483431-114483453 CTCACTAATTTTTGTATTTTTGG + Intronic
1074622447 10:115139274-115139296 CAAAGTCACTTCTACATTTTCGG + Intronic
1075826251 10:125359171-125359193 CCAAGTCACTTCTACATTTTCGG + Intergenic
1076349193 10:129803291-129803313 CTCTGTCAGTTCTACATGTTAGG + Intergenic
1076410105 10:130243004-130243026 CTCTCTCCTTTTTACATTTAAGG + Intergenic
1077205387 11:1340098-1340120 CTCATTCATTCCTAGATATTTGG + Intergenic
1078404681 11:11060035-11060057 CTCAATTATTTCTATACTTTAGG + Intergenic
1081011197 11:37813936-37813958 CTTTCTCATTTCTATATCTTTGG + Intergenic
1081973522 11:47216160-47216182 CTCACTCATTTTTTTATTTCTGG + Intronic
1085680535 11:78570547-78570569 CAAACTCATTTTTATATTTTTGG + Intronic
1086275550 11:85124057-85124079 CTCTCTCATTTCCTCATTTCTGG - Intronic
1086758939 11:90603028-90603050 CAAAGTCATTTCCACATTTTTGG - Intergenic
1087341704 11:96915331-96915353 CAAAGTCATTTCCACATTTTCGG - Intergenic
1087592411 11:100208022-100208044 CTGTCTCATTTTTATATTTTAGG + Intronic
1088050827 11:105513641-105513663 CTGGCTAATTTTTACATTTTTGG + Intergenic
1088234793 11:107711464-107711486 CACACACATTTATACACTTTAGG + Intronic
1088445735 11:109925706-109925728 TTGACTCATTTTTGCATTTTTGG - Intergenic
1090891502 11:130927065-130927087 CTGACTAATTTTTATATTTTTGG - Intergenic
1092325678 12:7528612-7528634 CAAACTCACTTCTACATTTTTGG - Intergenic
1093139089 12:15487117-15487139 TTCACTCATTGCTAACTTTTTGG + Intronic
1093270678 12:17057109-17057131 CTCAGTCATTTTACCATTTTTGG - Intergenic
1093624140 12:21326349-21326371 CAAAGTCATTTCCACATTTTTGG - Intronic
1093923236 12:24883122-24883144 CTGGCTCATTTTTATATTTTTGG - Intronic
1094759721 12:33516957-33516979 CTAAATCATGTCTAAATTTTCGG + Intergenic
1095196108 12:39319422-39319444 CTCTCTCATGTTTACATTGTTGG - Intronic
1095340081 12:41079830-41079852 CAAAGTCACTTCTACATTTTTGG - Intergenic
1095600218 12:44004663-44004685 CTCTTTCATTTCTACTTTATTGG + Intronic
1095623105 12:44282292-44282314 CAAAGTCATTTCCACATTTTTGG - Intronic
1096414731 12:51403334-51403356 CTTACTCATTTCCAGAGTTTGGG + Intronic
1097476059 12:60057737-60057759 CACAGTCACTTCCACATTTTTGG - Intergenic
1097522925 12:60690537-60690559 CAAAGTCATTTCCACATTTTTGG - Intergenic
1097580564 12:61451642-61451664 ATCATTTATTTATACATTTTAGG - Intergenic
1098092769 12:66921612-66921634 CTCACTCATTTGTACACTGGGGG + Intergenic
1098741679 12:74179961-74179983 CAAAGTCACTTCTACATTTTTGG + Intergenic
1099703910 12:86125822-86125844 GTCACTCATTGCTTCCTTTTGGG - Intronic
1100041431 12:90323265-90323287 CTCAGTCATTTCTATTTTATTGG - Intergenic
1100061777 12:90587730-90587752 CTGACGCATTTCTACAGTCTGGG + Intergenic
1102105852 12:110322432-110322454 CTCACTGATCTCTACATCCTGGG + Intronic
1102397614 12:112600729-112600751 CAAAGTCATTTCCACATTTTGGG + Intronic
1103669780 12:122603855-122603877 GGCACTCACTGCTACATTTTTGG + Intronic
1104491051 12:129193765-129193787 CTTACTCATTTCTATATTCCTGG - Intronic
1104571659 12:129931171-129931193 CTCTTTCCTTTCTACATTGTAGG - Intergenic
1105212690 13:18266678-18266700 TTCACTCATTTGTTCATTTGTGG - Intergenic
1105421541 13:20256750-20256772 CTCACTGCTTTGTACATTTTAGG - Intergenic
1105573023 13:21622201-21622223 CTCAGTCAACTCTTCATTTTTGG - Intergenic
1106258681 13:28045014-28045036 CTCACTCATTCCTACTTATCTGG - Intronic
1106372119 13:29145222-29145244 CTTACTCATTTATGAATTTTAGG - Intronic
1106827940 13:33544511-33544533 CCGACTGCTTTCTACATTTTAGG - Intergenic
1107270865 13:38614475-38614497 TTCACTGATTTCTCCTTTTTAGG + Intergenic
1108098096 13:46925924-46925946 CTCACTCATTACTATTTATTAGG + Intergenic
1108113027 13:47097698-47097720 AACACTCATTTTTACCTTTTAGG - Intergenic
1108625001 13:52219150-52219172 CCCACTTACTTATACATTTTTGG - Intergenic
1108661051 13:52587267-52587289 CCCACTTACTTATACATTTTTGG + Intergenic
1108724434 13:53164423-53164445 CAAAGTCATTTCCACATTTTCGG + Intergenic
1108874919 13:55034566-55034588 CTGACTAATTTTTATATTTTTGG - Intergenic
1108899892 13:55388890-55388912 TTCATTTGTTTCTACATTTTGGG + Intergenic
1109064159 13:57663322-57663344 GTCAGACATTTGTACATTTTAGG - Intronic
1109223977 13:59670451-59670473 CTTGCTCATTTCTACAGTTTTGG - Intronic
1109576196 13:64262908-64262930 CAAAGTCATTTCCACATTTTTGG - Intergenic
1109912048 13:68925516-68925538 CTCATAGTTTTCTACATTTTTGG + Intergenic
1111026527 13:82535172-82535194 CTTATTAATTTCTACATATTTGG - Intergenic
1111082721 13:83333275-83333297 CTCACTCAATTATGCATTTGTGG - Intergenic
1111125203 13:83906264-83906286 CTTGCTCATTTCTGCATTGTTGG - Intergenic
1111358688 13:87145535-87145557 CAAAGTCATTTCCACATTTTTGG - Intergenic
1112887378 13:104191371-104191393 CTTACTAATTTGTACATTTCTGG - Intergenic
1113168054 13:107465844-107465866 CTCACCCATTTCACCATTTGAGG - Intronic
1113497635 13:110744464-110744486 CAAAGTCATTTCCACATTTTTGG + Intergenic
1115055320 14:29118746-29118768 CTTTATCATTTCAACATTTTGGG + Intergenic
1115272892 14:31573988-31574010 CTCACTCATTCATTCATTTGTGG - Intronic
1115659029 14:35473028-35473050 TGCACTCTTTTCTATATTTTAGG + Intergenic
1115734155 14:36305913-36305935 CTCACTCATGTCCCTATTTTAGG + Intronic
1116246290 14:42417452-42417474 CTCAATCTTTTCTACTTTTGGGG - Intergenic
1116378497 14:44233248-44233270 CAAAGTCACTTCTACATTTTGGG + Intergenic
1116533753 14:46005923-46005945 CAAATTCACTTCTACATTTTTGG - Intergenic
1120165861 14:81198919-81198941 CTAAGTAATTTCTACATCTTGGG + Intronic
1120409869 14:84140951-84140973 TTCACTAAATTCAACATTTTTGG - Intergenic
1120582709 14:86272790-86272812 CAAAGTCACTTCTACATTTTTGG + Intergenic
1121035567 14:90700525-90700547 CTCACTCTTTTCTTTCTTTTGGG - Intronic
1123187384 14:106532849-106532871 TTTACTCATTTCTACAATTATGG + Intergenic
1123956990 15:25346884-25346906 GTCACTCTTTTCTCCATTCTAGG - Intronic
1124243225 15:28048842-28048864 CTCACTAATTTTTGTATTTTGGG - Intronic
1125528844 15:40397638-40397660 CTCGCTAATTTTTAAATTTTTGG + Intergenic
1127028340 15:54833376-54833398 ATAACTCATTACTACATTTTTGG + Intergenic
1127043047 15:54998171-54998193 AGCACTCATTTCTACACATTAGG + Intergenic
1127232022 15:57006753-57006775 CTCGCTCATTTTTGTATTTTTGG - Intronic
1127934912 15:63627700-63627722 CTTACACATTTCTTCATATTTGG - Intronic
1130210526 15:81917851-81917873 CAAAGTCACTTCTACATTTTTGG - Intergenic
1130395531 15:83497641-83497663 CTCACTCTTTTCTTCATTGCTGG + Intronic
1130824886 15:87533628-87533650 GTCAGTCACTTCCACATTTTTGG + Intergenic
1131345619 15:91645279-91645301 TTTTCTCATTTCAACATTTTTGG - Intergenic
1132824958 16:1899932-1899954 CTGACTAATTTTTACATTTTTGG - Intergenic
1133273475 16:4623096-4623118 CTGGCTAATTTTTACATTTTTGG + Intronic
1137673778 16:50293751-50293773 CTCACACAGTTTTACAGTTTTGG - Intronic
1137908733 16:52353914-52353936 ATTAATCATTTCTTCATTTTTGG - Intergenic
1138069073 16:53972711-53972733 TTCAATCAGCTCTACATTTTAGG + Intronic
1139894641 16:70278744-70278766 CTCACTCATCTCTGTATCTTCGG + Intronic
1141845861 16:86608605-86608627 CTGACTCAGTCATACATTTTAGG + Intergenic
1144116379 17:12096399-12096421 CAAACTCACTTCCACATTTTAGG - Intronic
1146652618 17:34615976-34615998 CTCACTCCGTTGTACAGTTTAGG + Intronic
1148183903 17:45627510-45627532 CTAGCTAATTTTTACATTTTTGG + Intergenic
1148264834 17:46217312-46217334 CTAGCTAATTTTTACATTTTTGG - Intronic
1149158863 17:53666886-53666908 CAAAGTCATTTCCACATTTTTGG - Intergenic
1150561088 17:66295601-66295623 CTCACTATTTTTTATATTTTTGG + Intergenic
1150952568 17:69820339-69820361 CTTATTCATTCCTACCTTTTTGG + Intergenic
1153960455 18:10135749-10135771 CTGACTCATTCCTCCATTCTAGG + Intergenic
1153998720 18:10464787-10464809 CTCACTCTCTTCTACATTGAGGG + Intronic
1156172702 18:34505627-34505649 CCCACTGATTTTTATATTTTGGG + Intronic
1156651005 18:39227313-39227335 CAAAGTCACTTCTACATTTTCGG - Intergenic
1156697576 18:39785419-39785441 TTCACTTATTTCTTCATCTTAGG - Intergenic
1156860796 18:41834056-41834078 CTAAATCATTTCTATAATTTTGG - Intergenic
1156921117 18:42523403-42523425 CTCAGCCATTGCTAGATTTTAGG + Intergenic
1157163901 18:45340294-45340316 CACAGTCATTTCTAAATCTTAGG - Intronic
1158103645 18:53859866-53859888 TTCAATTATTTCTACATCTTCGG + Intergenic
1158222902 18:55168595-55168617 CAAAGTCATTTCCACATTTTCGG - Intergenic
1158905165 18:62004538-62004560 CTCTCTCATTTCCAAACTTTGGG - Intergenic
1158984769 18:62802710-62802732 CTCATCCATTTATACATTCTCGG - Intronic
1159261400 18:66017066-66017088 CAAAGTCATTTCCACATTTTTGG + Intergenic
1159348959 18:67246046-67246068 TTCAATTATTTCTACATTCTAGG + Intergenic
1161863812 19:6819298-6819320 ATCGCTCATTTCTAGTTTTTAGG - Intronic
1163010892 19:14425393-14425415 CTGACTAATTTTTATATTTTTGG + Intergenic
1163840769 19:19608189-19608211 CTGGCTCATTTTTGCATTTTTGG - Intronic
1164412363 19:28016615-28016637 CTCACTAAGTTCTTCATTTAGGG - Intergenic
1164841335 19:31394666-31394688 GTTACCCATTTCCACATTTTTGG - Intergenic
1165230327 19:34382725-34382747 CTAACTCATCTCTACATGCTGGG - Intronic
1168012221 19:53542247-53542269 CTCACATATTTCTACCTTGTAGG + Intronic
925583549 2:5439276-5439298 ATCACTCATTTCCACAGTCTTGG - Intergenic
925702825 2:6656084-6656106 TTCATTCATTTATTCATTTTGGG + Intergenic
925805257 2:7642052-7642074 CAAAGTCATTTCCACATTTTTGG + Intergenic
926692763 2:15748542-15748564 CCCACTCACTTCTACATTTGGGG - Intergenic
926955443 2:18290306-18290328 GTCACTCTTCTCTACATTTGGGG - Intronic
928858233 2:35826011-35826033 CTCAGATTTTTCTACATTTTGGG - Intergenic
929327405 2:40633435-40633457 CTTACTAATTTTTACATATTTGG - Intergenic
930393490 2:50790373-50790395 CTCAGGCATTTCTAGATTTTGGG + Intronic
931047925 2:58377723-58377745 CTCACTCATTTCTACTCATTTGG + Intergenic
931143275 2:59487294-59487316 CCCACTCCTATTTACATTTTTGG + Intergenic
931734388 2:65180813-65180835 CAAACTCACTTCCACATTTTTGG - Intergenic
931823357 2:65974444-65974466 CTCTCTCCTTTATACTTTTTTGG - Intergenic
932078232 2:68686560-68686582 CTTACTCTTTTCTCCATTTCTGG - Intronic
933498426 2:83081339-83081361 GTCTCTCATTTCTTCATATTTGG + Intergenic
933762865 2:85685275-85685297 CTCACTGATGTTTATATTTTGGG + Intronic
933798811 2:85943313-85943335 CAAAGTCATTTCCACATTTTTGG + Intergenic
934144049 2:89074516-89074538 CAAAGTCATTTCCACATTTTTGG - Intergenic
934225195 2:90126036-90126058 CAAAGTCATTTCCACATTTTTGG + Intergenic
934537297 2:95145732-95145754 TTCATGCATTTTTACATTTTAGG - Intronic
934866443 2:97817537-97817559 CACAGTAATTTCTACATTTGTGG - Intronic
935626085 2:105173367-105173389 CAAAGTCATTTCCACATTTTTGG + Intergenic
935915030 2:107940058-107940080 CTCACTCATATCTAGAGTGTGGG - Intergenic
937008253 2:118538016-118538038 CTCACTGTTTTCTATAGTTTTGG - Intergenic
939131984 2:138246141-138246163 CTCATACATTTCTACAGTTATGG - Intergenic
939739931 2:145893620-145893642 CTACCACATTACTACATTTTAGG - Intergenic
940483993 2:154274782-154274804 CAAAGTCACTTCTACATTTTTGG - Intronic
940814774 2:158286207-158286229 CAGATTCATTTCTACATATTTGG - Intronic
940948672 2:159647071-159647093 CAAAGTCATTTCCACATTTTAGG + Intergenic
941267501 2:163380894-163380916 CTCCATTATTCCTACATTTTGGG - Intergenic
942130186 2:172870930-172870952 TTAACTCAATTCTAAATTTTTGG + Intronic
942907789 2:181204855-181204877 ATCAATTATTTGTACATTTTTGG - Intergenic
942983677 2:182113161-182113183 CTCACTCATTTGTTTATTTCTGG + Intronic
943383529 2:187176983-187177005 CAAACTCAATTCTAAATTTTAGG - Intergenic
943587839 2:189761382-189761404 CTTAGTCATTTCCACTTTTTTGG - Intronic
943996950 2:194781330-194781352 GTCAATCATTTCATCATTTTGGG - Intergenic
944043950 2:195387704-195387726 CTAAGTCACTTCCACATTTTCGG - Intergenic
944386594 2:199171786-199171808 CTCTTTCATTTCTATATTGTTGG + Intergenic
944977506 2:205072410-205072432 CTGGCTAATTTTTACATTTTTGG + Intronic
946213664 2:218167039-218167061 CCCACCCATGTCTACATTTGGGG + Intergenic
947884660 2:233557780-233557802 CTCCTTCCTTTCTACTTTTTTGG - Intronic
948492459 2:238321856-238321878 CTCACTCTTTTCAACAGGTTGGG + Intronic
1168830600 20:843311-843333 CTCACTCCCTTCTGGATTTTTGG + Intronic
1170075888 20:12418570-12418592 GTCAATTACTTCTACATTTTTGG + Intergenic
1170251610 20:14289701-14289723 CTGGCTAATTTCTGCATTTTTGG + Intronic
1171047615 20:21825669-21825691 CTCACTTAGTTATACATTTTGGG - Intergenic
1171454373 20:25259185-25259207 CTCATTCCATTCTACACTTTAGG - Intronic
1172483151 20:35283636-35283658 CTGGCTAATTTTTACATTTTTGG - Intronic
1173712800 20:45175444-45175466 CTCACTCATTTCTACATTTTTGG - Intronic
1175342715 20:58244552-58244574 ATCACTTATTTCTAGATCTTCGG + Intergenic
1177210194 21:18061080-18061102 GTCAGTCATTTCTTCATTTTGGG + Intronic
1177768943 21:25493089-25493111 CTCAGTGAATTCTACACTTTAGG + Intergenic
1177854104 21:26382716-26382738 CAAACTCACTTCCACATTTTTGG - Intergenic
1177952286 21:27553098-27553120 CAAAGTCACTTCTACATTTTAGG + Intergenic
1178220079 21:30646159-30646181 CTCACTCATCTGTTTATTTTAGG - Intergenic
1178242316 21:30917063-30917085 ATCACTCATTTCTAGACTTCTGG - Intergenic
1178249792 21:30991567-30991589 CTCACTCATTTCTCCATTTTTGG + Intergenic
1178469132 21:32875994-32876016 CAAACTCACTTCCACATTTTTGG + Intergenic
1178610815 21:34077807-34077829 CCAACTGTTTTCTACATTTTAGG - Intronic
1179458741 21:41518892-41518914 GTAACTCATTTCTAAAATTTTGG - Intronic
1179678352 21:43000203-43000225 CAAAGTCACTTCTACATTTTTGG + Intronic
1180573560 22:16751788-16751810 CAAAGTCACTTCTACATTTTTGG - Intergenic
1180657923 22:17439815-17439837 TTCACTCTGTTCTCCATTTTAGG - Intronic
1180815507 22:18787002-18787024 TTCACTCATTTGTTCATTTGTGG - Intergenic
1180918842 22:19508001-19508023 AACACTCATTTGTACATTCTCGG - Intronic
1181117007 22:20638070-20638092 CTGAGTTATTTCTAGATTTTTGG - Intergenic
1181201697 22:21221337-21221359 TTCACTCATTTGTTCATTTGTGG - Intronic
1181700060 22:24615634-24615656 TTCACTCATTTGTTCATTTGTGG + Intronic
1184832750 22:47000044-47000066 CTCCCTCTTTTCTGCGTTTTAGG + Intronic
1184963981 22:47953478-47953500 CTCACTCAACTCTACCATTTGGG + Intergenic
1185226001 22:49653023-49653045 CTCGCTAATTTTTATATTTTTGG - Intronic
1203225217 22_KI270731v1_random:74091-74113 TTCACTCATTTGTTCATTTGTGG + Intergenic
1203265610 22_KI270734v1_random:12693-12715 TTCACTCATTTGTTCATTTGTGG - Intergenic
949554662 3:5142650-5142672 CTCAATTATTTTTACCTTTTAGG + Intronic
949691511 3:6645368-6645390 CTGGCTAATTTCTAAATTTTTGG - Intergenic
949736970 3:7184240-7184262 CTCACAAATTTTTACTTTTTCGG - Intronic
950023353 3:9804263-9804285 GTCACTCATTTCTACATCTCAGG + Intronic
951224367 3:20104076-20104098 CTCACTCAATTATACATTTAAGG - Intronic
951679476 3:25279978-25280000 CTCACACATTGCTAGATTTGCGG + Intronic
952396976 3:32929762-32929784 CAAAGTCATTTCCACATTTTTGG - Intergenic
952608826 3:35182441-35182463 CAAAGTCATTTCCACATTTTTGG + Intergenic
953252919 3:41262700-41262722 CTACCTCCTTTCTTCATTTTAGG + Intronic
953790260 3:45942064-45942086 CTCACTCATTTGTACCAGTTTGG + Intronic
954973261 3:54669809-54669831 CTGGCTAATTTTTACATTTTTGG + Intronic
956019844 3:64922459-64922481 ATTACTCATTTCCCCATTTTTGG - Intergenic
956277717 3:67521187-67521209 CTTTCTCATTTATATATTTTTGG - Intronic
956429580 3:69172092-69172114 TTCCCTTATCTCTACATTTTGGG - Intronic
959788929 3:110333463-110333485 CAAAGTCATTTCCACATTTTTGG + Intergenic
959838713 3:110949966-110949988 CACAGTCACTTCCACATTTTTGG + Intergenic
959875066 3:111373008-111373030 CTTTCCCACTTCTACATTTTGGG - Intronic
959915361 3:111810726-111810748 AACACTGATTTCTACATTTAGGG - Intronic
960080527 3:113535330-113535352 TTCACTTATTTGTTCATTTTTGG - Intronic
960516430 3:118607663-118607685 CTTTCTCATTTCCACAGTTTGGG - Intergenic
960765104 3:121118611-121118633 CTCAATCAAATCTATATTTTAGG + Intronic
961028267 3:123580312-123580334 CTGGCTCATTTTTATATTTTTGG - Intronic
962686597 3:137853879-137853901 ATCACACATTTCTTCATTATGGG + Intergenic
963422193 3:145074158-145074180 CTAAGTCACTTCCACATTTTTGG + Intergenic
963452237 3:145496943-145496965 CACACTCATTAATATATTTTTGG - Intergenic
963581939 3:147136206-147136228 CAAAGTCACTTCTACATTTTTGG + Intergenic
963721772 3:148869641-148869663 ATGACTCATTTCTGCATCTTTGG - Intronic
965013527 3:163126897-163126919 CTAAATCACTTCCACATTTTTGG + Intergenic
965013531 3:163126949-163126971 CTAATTCAATTCCACATTTTTGG + Intergenic
965013535 3:163126993-163127015 CTAATTCACTTCCACATTTTTGG + Intergenic
965102034 3:164310380-164310402 CTAAGTCACTTCCACATTTTTGG + Intergenic
965247749 3:166296503-166296525 CTCAGTCATTGCTACTCTTTTGG - Intergenic
965355598 3:167669200-167669222 CTCATTCATGTCCACATTTGAGG - Intergenic
965370835 3:167860208-167860230 AACACTCATTTTTACATTTCTGG - Intergenic
965386746 3:168055156-168055178 CAAAGTCATTTCTACATTTTTGG - Intronic
965533130 3:169795513-169795535 TTCTCTCATATCTACATTTGGGG - Exonic
965662020 3:171052127-171052149 CAAACTCACTTCCACATTTTGGG - Intergenic
965987393 3:174772121-174772143 CTGATTTATTTCTATATTTTGGG - Intronic
966031905 3:175359846-175359868 CTCCCTCCTTTCTTCATTTCTGG - Intronic
967614488 3:191548164-191548186 CAAAGTCATTTCCACATTTTTGG + Intergenic
967628682 3:191716735-191716757 CTCAATAATTTGGACATTTTTGG - Intergenic
967777304 3:193397745-193397767 CTCATTCATTTCCCCATTATGGG + Intergenic
969367581 4:6707262-6707284 TTCATTCATTTCTACTTTTCAGG + Intergenic
969984161 4:11189859-11189881 CTCACTCATCTCTTCATTAATGG + Intergenic
970306203 4:14734899-14734921 CAAAGTCATTTCCACATTTTTGG + Intergenic
970336709 4:15053515-15053537 ATCACTCATTCTTACATTTTAGG + Intronic
970750524 4:19353818-19353840 CAAACTCACTTCCACATTTTTGG + Intergenic
971918080 4:32900548-32900570 CTCACTAACTCATACATTTTAGG - Intergenic
972113647 4:35599068-35599090 CTTACTCATTACTTCAATTTAGG + Intergenic
972887603 4:43511123-43511145 CAAAGTCATTTCCACATTTTTGG + Intergenic
973189375 4:47369458-47369480 CACACTCATTTCTACAAAATAGG + Intronic
974239182 4:59222911-59222933 TTCACTCATTTTCACATTTTTGG - Intergenic
974661221 4:64891858-64891880 CTCTCTTAGTTTTACATTTTTGG + Intergenic
974799597 4:66800002-66800024 CTCTTTTATTTCTACATCTTAGG + Intergenic
975471757 4:74777440-74777462 CTGACAAATTTCTACATTTATGG + Intronic
975957392 4:79857656-79857678 CTCTCTCATTTTATCATTTTAGG + Intergenic
976726560 4:88221392-88221414 CAAAGTCGTTTCTACATTTTTGG - Intronic
976875713 4:89851145-89851167 CAAAGTCATTTCCACATTTTGGG + Intergenic
977197610 4:94082132-94082154 CAAAGTCATTTCCACATTTTTGG + Intergenic
977801105 4:101232950-101232972 CTTCTTCATTTCTACATATTAGG + Intronic
978045079 4:104115403-104115425 CAAAGTCACTTCTACATTTTTGG + Intergenic
978447899 4:108798342-108798364 CTCCCTCTTTCTTACATTTTTGG + Intergenic
978910356 4:114055538-114055560 TTCTCTCATTTTCACATTTTTGG + Intergenic
979168502 4:117568816-117568838 CTCATTCATTTTTCAATTTTAGG - Intergenic
979755641 4:124337382-124337404 CTCACACAAATCTACATTGTAGG - Intergenic
980084267 4:128375646-128375668 CTCAAACATTTCAACCTTTTTGG - Intergenic
980324382 4:131323280-131323302 CAAAGTCACTTCTACATTTTTGG - Intergenic
982079533 4:151775323-151775345 GTCACTCATGTCTGCATTCTAGG + Intergenic
982243744 4:153327448-153327470 CTCTTTCAGTTCTACATTTGAGG + Intronic
982787684 4:159555475-159555497 GTGACTCATTTTAACATTTTGGG + Intergenic
985099031 4:186439603-186439625 CTCATTAACTTCAACATTTTTGG - Intronic
985398464 4:189569724-189569746 CCCAATCATTTCACCATTTTTGG - Intergenic
985922936 5:2993705-2993727 ATGACTCATTTCTATCTTTTGGG - Intergenic
986563218 5:9084764-9084786 CAAAGTCACTTCTACATTTTGGG - Intronic
987182366 5:15381116-15381138 CTCTCTGAATTCTACATTTCGGG - Intergenic
987606825 5:20146875-20146897 GACTCTCATTTCTACATCTTAGG + Intronic
987788446 5:22532741-22532763 TTCACTAATTCCAACATTTTGGG - Intronic
987865623 5:23532524-23532546 TTCATTTATCTCTACATTTTCGG + Intergenic
988132985 5:27130130-27130152 CTGACTCATGTCAGCATTTTGGG - Intergenic
988535278 5:32062553-32062575 CTGGCTAATTTTTACATTTTTGG + Intronic
988819651 5:34868945-34868967 CGCACTCATTTCTGCAGTTTTGG - Exonic
989333991 5:40292860-40292882 CTGTCTCTTTTCCACATTTTCGG + Intergenic
990108541 5:52293978-52294000 CAAAGTCGTTTCTACATTTTTGG + Intergenic
990691704 5:58371479-58371501 CACACACATATCTACATTTGTGG - Intergenic
991068722 5:62453380-62453402 CTGACTCCTTTCCACATTATAGG - Intronic
991237888 5:64419845-64419867 CTCAGTCATATCTACATTAGGGG - Intergenic
991409283 5:66330769-66330791 CAAAGTCATTTCCACATTTTCGG - Intergenic
991454790 5:66791183-66791205 CTGACTAATTTTTGCATTTTTGG + Intronic
992352397 5:75943698-75943720 CTCACTTGTTTCCACATTTTAGG - Intergenic
992666760 5:79017969-79017991 CTCACTCATTGATAAATATTTGG - Intronic
993684441 5:90920934-90920956 CTCTTTCTTTTCTGCATTTTAGG + Intronic
994359256 5:98831622-98831644 CTTAGTCATTTCTACTTATTTGG + Intergenic
995051320 5:107708030-107708052 CTCAGTCATTTTTACAAATTAGG - Intergenic
995167969 5:109069222-109069244 CACATTCCTTTCTACATTTATGG - Intronic
995727170 5:115193284-115193306 CTGACCAATATCTACATTTTTGG + Intergenic
995787675 5:115847456-115847478 CTCACTAATTTTTGTATTTTTGG - Intronic
996289614 5:121836329-121836351 ATGACTAATTTCTACATTTATGG + Intergenic
996636037 5:125691303-125691325 CAAAGTCATTTCCACATTTTCGG - Intergenic
996795709 5:127344152-127344174 CTCACTGGTTTTTACATTGTAGG - Intronic
999754970 5:154657478-154657500 CTCACTCATTGCTTGATCTTAGG - Intergenic
999927816 5:156398288-156398310 CCCACTCATTTCTTCATTCCGGG - Intronic
1000030602 5:157398018-157398040 CAAAGTCATTTCCACATTTTTGG + Intronic
1000751482 5:165100700-165100722 CACAGTCACTTCCACATTTTTGG + Intergenic
1002823210 6:748416-748438 GTCTCTAATTTCTACAGTTTTGG + Intergenic
1003262803 6:4537006-4537028 CTAGCTAATTTCTGCATTTTTGG + Intergenic
1003306091 6:4930933-4930955 CGCACTAATTTCCACAGTTTGGG + Intronic
1003662991 6:8081727-8081749 TTCATTCATTTATTCATTTTTGG - Intronic
1004107463 6:12678909-12678931 CTGGCTAATTTTTACATTTTTGG - Intergenic
1004689257 6:17977489-17977511 TTTAATCATTTCTATATTTTTGG - Intronic
1008741884 6:54618450-54618472 CTCAATATTTTATACATTTTTGG - Intergenic
1009490858 6:64288982-64289004 CAGTCTCATTTCTTCATTTTTGG + Intronic
1010448366 6:75974626-75974648 CTGGCTAATTTTTACATTTTTGG + Intronic
1011013862 6:82733093-82733115 CTCACTCATTTGTTAACTTTCGG + Intergenic
1011140371 6:84148365-84148387 CTGACTAATTTTTATATTTTTGG - Intronic
1011833613 6:91403872-91403894 CTTTCTCATTTCCACAGTTTGGG - Intergenic
1011981793 6:93387488-93387510 CTAAGTCACTTCCACATTTTAGG + Intronic
1012005317 6:93706923-93706945 CAAAGTCATTTCCACATTTTTGG - Intergenic
1012074561 6:94668512-94668534 CAAAGTCACTTCTACATTTTCGG - Intergenic
1012185959 6:96217452-96217474 CTCACTTATCTTTACAATTTAGG - Intergenic
1013203357 6:107923598-107923620 CTCACTCATCTCAACCTTCTTGG + Intronic
1014698369 6:124652471-124652493 CTCAATCGTTTCCACATTTTCGG + Intronic
1015755950 6:136606581-136606603 CTGACTCATTGCTAGACTTTAGG - Intronic
1016477436 6:144442390-144442412 CAAAGTCACTTCTACATTTTAGG + Intronic
1016563224 6:145420906-145420928 CTAACTCATTTCTACAATAATGG + Intergenic
1016886169 6:148961758-148961780 CTCACTCATGATTTCATTTTGGG - Intronic
1017139168 6:151175005-151175027 CACACATATTTCTATATTTTTGG - Intergenic
1017529735 6:155277213-155277235 CTCTCTCATTTATTCATATTTGG + Intronic
1017866722 6:158450452-158450474 CTCATTCATTTATTCATTTTAGG + Intronic
1018221569 6:161585868-161585890 CTCACTGACCTCTACATATTTGG + Intronic
1018242927 6:161795795-161795817 CTAACTCATTTTTGCTTTTTCGG - Intronic
1018516217 6:164582426-164582448 CAAAGTCACTTCTACATTTTTGG + Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1020407418 7:7853232-7853254 CTCTCTGATTTCAAAATTTTAGG - Intronic
1020712350 7:11623660-11623682 CTCACTCATCTCTCCCTCTTCGG + Intronic
1020837315 7:13169223-13169245 CTCAGTCACTTCCACATTTTTGG + Intergenic
1022434866 7:30373377-30373399 CTGTCTCATATCTACATTCTTGG - Intronic
1022594294 7:31697254-31697276 CACACTCAGTGCTACCTTTTAGG + Intronic
1023132865 7:37020280-37020302 CTCTCTAAGTTCTACAATTTTGG - Intronic
1023181030 7:37484021-37484043 ATCAGACATTTCTACAGTTTAGG + Intergenic
1023356740 7:39374985-39375007 CTAACTGCTTTCTACAGTTTGGG + Intronic
1023369039 7:39494272-39494294 CCCATGCATATCTACATTTTTGG - Intergenic
1023485600 7:40682858-40682880 CTCATTCCATTCTACATTTTTGG + Intronic
1024166150 7:46733073-46733095 CTGGCTAATTTTTACATTTTTGG + Intronic
1024386101 7:48753833-48753855 ATCAAACATTTCTACATTATTGG + Intergenic
1026305892 7:69141428-69141450 CCCACTAATTTTTATATTTTTGG + Intergenic
1027428624 7:78086794-78086816 CTGACTAATTTTTATATTTTTGG + Intronic
1027526787 7:79279206-79279228 CTCACTTATTTCTATATTCCTGG + Intronic
1028317334 7:89419845-89419867 GTCACTCATTTTTAGATATTTGG + Intergenic
1028493559 7:91440421-91440443 CAAAGTCATTTCCACATTTTTGG - Intergenic
1030294169 7:107903851-107903873 CTCAGTGATTTCCAGATTTTAGG - Intronic
1030517283 7:110553758-110553780 CACACTCATTTCTACCTTGTTGG + Intergenic
1031165798 7:118225324-118225346 CCCACTAATTTTTGCATTTTTGG - Intronic
1031374900 7:121012385-121012407 CTCATTCTTTTCTAAATTCTGGG + Intronic
1031674124 7:124588435-124588457 CAAAGTCATTTCCACATTTTTGG - Intergenic
1033110425 7:138569304-138569326 TTCATTCATGTTTACATTTTTGG - Intronic
1033832964 7:145275706-145275728 CTAACTCACTTCCACATCTTTGG - Intergenic
1033988469 7:147255381-147255403 CTGACTAATTTCTGTATTTTTGG + Intronic
1035207585 7:157304234-157304256 CTGGCTCATTTTTGCATTTTTGG + Intergenic
1036117499 8:5973805-5973827 CTCACATATGTGTACATTTTTGG + Intergenic
1037118765 8:15257830-15257852 CTAATGCATTTCTGCATTTTTGG + Intergenic
1037309582 8:17540644-17540666 ATCACTAATTTATTCATTTTGGG + Intronic
1039079431 8:33721207-33721229 CTTACTCATTTCTGCCTTGTTGG - Intergenic
1040801293 8:51344074-51344096 CTCATTCATTCATTCATTTTGGG + Intronic
1040941659 8:52840188-52840210 CTCACTAATTTTTACCTTTGTGG + Intergenic
1041686187 8:60647127-60647149 CTTACTCATCTGTACCTTTTTGG - Intergenic
1041967586 8:63697915-63697937 CTCAGTCATAACTACATATTAGG + Intergenic
1043879757 8:85529115-85529137 CTCATTCATTTATTTATTTTTGG - Intergenic
1044538341 8:93382495-93382517 CAAAGTCACTTCTACATTTTTGG + Intergenic
1044864585 8:96557983-96558005 CTAACCCATGTCTACATTTAGGG + Intronic
1045101524 8:98849437-98849459 CTCACCCAGTTCTTCATGTTAGG + Intronic
1045633916 8:104160246-104160268 CTCATTCATTTTTACATCTCTGG + Intronic
1045959071 8:107945798-107945820 CTCATTCCTTTCAACATTTGAGG + Intronic
1048026789 8:130594613-130594635 CTCACTCATTTCCATAGTTATGG + Intergenic
1050243219 9:3659532-3659554 CCCCCACATTTCCACATTTTGGG - Intergenic
1050854683 9:10338009-10338031 TTCACTCATTTCTCCATATCAGG + Intronic
1051088895 9:13383463-13383485 TACATTCATCTCTACATTTTTGG + Intergenic
1051464135 9:17356907-17356929 GTAAATCATTTCTATATTTTAGG - Intronic
1051914932 9:22197387-22197409 CAAAGTCATTTCCACATTTTTGG - Intergenic
1052204022 9:25816253-25816275 CTAACTGATTTCTAAATTTTTGG + Intergenic
1053241050 9:36495929-36495951 CTCAGACTTTTATACATTTTTGG + Intergenic
1055456034 9:76472378-76472400 TTCACTCAATTCTACTTTTTTGG - Intronic
1058637807 9:107053608-107053630 CTCAGCCAGTTCTACATTTTAGG + Intergenic
1058978498 9:110147087-110147109 CTGGCTCATTTTTATATTTTTGG - Intronic
1059206370 9:112470410-112470432 CTCTCTCATTTTCTCATTTTAGG + Exonic
1059740880 9:117148429-117148451 CTCATTCATTTTGAAATTTTTGG + Intronic
1062292716 9:135804321-135804343 CTGACTAATTTTTGCATTTTTGG - Intergenic
1186161279 X:6779471-6779493 TTGACTCACTTCTACATTCTTGG + Intergenic
1186767302 X:12783876-12783898 CTCACTGATTTTTACATATTTGG + Intergenic
1187545013 X:20242033-20242055 CTCAGTTATTTCTAGATATTAGG - Intronic
1187555069 X:20343802-20343824 CTAAGTCACTTCCACATTTTCGG - Intergenic
1188141828 X:26559340-26559362 CTTGCTCATTTCTGCATTGTTGG + Intergenic
1188215106 X:27466622-27466644 GTCACACATTTCTGAATTTTAGG + Intergenic
1188289911 X:28374745-28374767 CTCCCTCATCTCTATATATTTGG + Intergenic
1188618174 X:32185176-32185198 CTCCCTCTTTTCTACCTTCTAGG + Intronic
1190169079 X:48097331-48097353 CCAACTAATTTCTATATTTTTGG - Intergenic
1190254149 X:48750031-48750053 CTGGCTAATTTTTACATTTTTGG - Intergenic
1190484353 X:50910141-50910163 CTCAGTAGTTTCCACATTTTAGG + Intergenic
1190845330 X:54185445-54185467 CTCTATCTGTTCTACATTTTAGG - Intergenic
1191116527 X:56858566-56858588 CAAAGTCACTTCTACATTTTTGG + Intergenic
1192083675 X:68072853-68072875 CTCACCCATTTCAATATATTGGG + Intronic
1192271346 X:69582635-69582657 CTCATTCATTCCTATATTTCTGG - Intergenic
1192670114 X:73131001-73131023 CTCATTCATTTATTCATTTATGG - Intergenic
1192935003 X:75850083-75850105 CAAAGTCATTTCCACATTTTCGG + Intergenic
1193843852 X:86444028-86444050 CTCTCTCATCTTTACGTTTTTGG + Intronic
1194204372 X:90994821-90994843 ATCAATCATTTCTTCATTTTAGG + Intergenic
1194404703 X:93481447-93481469 CTCATACATTTATACATTTCTGG + Intergenic
1194567811 X:95515214-95515236 CTCAATGATTCCTAGATTTTGGG + Intergenic
1194841826 X:98753026-98753048 CAAAGTCATTTCCACATTTTTGG + Intergenic
1195313201 X:103654047-103654069 CTCACTTATTTCTAGTGTTTGGG + Intergenic
1196410154 X:115410238-115410260 CTCACTATTTTCTACTTTCTGGG - Intergenic
1196431760 X:115634529-115634551 CTCACCCATTTAGGCATTTTTGG + Intronic
1196627577 X:117894180-117894202 CTCTCTCATTTCCACCTTTGTGG + Intergenic
1196912085 X:120493927-120493949 CTGACTAATTTTTATATTTTTGG - Intergenic
1197914455 X:131520260-131520282 CTAAGTCACTTCCACATTTTCGG - Intergenic
1198295815 X:135285198-135285220 CTCTTTCATTTCTACTTTATTGG + Intronic
1198891721 X:141403798-141403820 CTCACTCATTTGTACCATTCGGG + Intergenic
1199152143 X:144499440-144499462 CTCACCCATTTCTATCTTTTGGG - Intergenic
1199362994 X:146944227-146944249 CAAAGTCATTTCCACATTTTTGG + Intergenic
1200275927 X:154732603-154732625 TTCAAGCATTTCTACTTTTTAGG - Intronic
1200376451 X:155785715-155785737 TTCTTTCATTTCTCCATTTTTGG + Intergenic
1200381500 X:155842225-155842247 CAAAGTCATTTCCACATTTTCGG - Intergenic
1200550212 Y:4570261-4570283 ATCAATCATTTCTTCATTTTAGG + Intergenic
1200755499 Y:6986363-6986385 CTGGCTCATTTTTAAATTTTTGG - Intronic
1201054057 Y:9970776-9970798 CTCATTCATAACTAAATTTTAGG - Intergenic
1201297457 Y:12476453-12476475 CTCTCTCACATATACATTTTGGG + Intergenic
1202102391 Y:21323934-21323956 CTCATTCATGACTAAATTTTAGG - Intergenic
1202203249 Y:22376843-22376865 CTCATTCATAACTAAATTTTAGG + Intronic
1202240061 Y:22757730-22757752 CTCATTCATGACTAAATTTTAGG + Intergenic
1202393047 Y:24391492-24391514 CTCATTCATGACTAAATTTTAGG + Intergenic
1202477738 Y:25278625-25278647 CTCATTCATGACTAAATTTTAGG - Intergenic