ID: 1173714889

View in Genome Browser
Species Human (GRCh38)
Location 20:45194857-45194879
Sequence GACCACTCTCATTGGTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173714889_1173714898 25 Left 1173714889 20:45194857-45194879 CCCAGAGACCAATGAGAGTGGTC No data
Right 1173714898 20:45194905-45194927 AAGGAAAGAGAGAATGGAGATGG No data
1173714889_1173714894 -2 Left 1173714889 20:45194857-45194879 CCCAGAGACCAATGAGAGTGGTC No data
Right 1173714894 20:45194878-45194900 TCACCTATGTGGTCAGGAATTGG No data
1173714889_1173714893 -8 Left 1173714889 20:45194857-45194879 CCCAGAGACCAATGAGAGTGGTC No data
Right 1173714893 20:45194872-45194894 GAGTGGTCACCTATGTGGTCAGG No data
1173714889_1173714897 19 Left 1173714889 20:45194857-45194879 CCCAGAGACCAATGAGAGTGGTC No data
Right 1173714897 20:45194899-45194921 GGTAGAAAGGAAAGAGAGAATGG No data
1173714889_1173714896 6 Left 1173714889 20:45194857-45194879 CCCAGAGACCAATGAGAGTGGTC No data
Right 1173714896 20:45194886-45194908 GTGGTCAGGAATTGGTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173714889 Original CRISPR GACCACTCTCATTGGTCTCT GGG (reversed) Intergenic
No off target data available for this crispr