ID: 1173714894

View in Genome Browser
Species Human (GRCh38)
Location 20:45194878-45194900
Sequence TCACCTATGTGGTCAGGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173714889_1173714894 -2 Left 1173714889 20:45194857-45194879 CCCAGAGACCAATGAGAGTGGTC No data
Right 1173714894 20:45194878-45194900 TCACCTATGTGGTCAGGAATTGG No data
1173714891_1173714894 -10 Left 1173714891 20:45194865-45194887 CCAATGAGAGTGGTCACCTATGT No data
Right 1173714894 20:45194878-45194900 TCACCTATGTGGTCAGGAATTGG No data
1173714890_1173714894 -3 Left 1173714890 20:45194858-45194880 CCAGAGACCAATGAGAGTGGTCA No data
Right 1173714894 20:45194878-45194900 TCACCTATGTGGTCAGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173714894 Original CRISPR TCACCTATGTGGTCAGGAAT TGG Intergenic
No off target data available for this crispr