ID: 1173714897

View in Genome Browser
Species Human (GRCh38)
Location 20:45194899-45194921
Sequence GGTAGAAAGGAAAGAGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173714895_1173714897 -5 Left 1173714895 20:45194881-45194903 CCTATGTGGTCAGGAATTGGTAG No data
Right 1173714897 20:45194899-45194921 GGTAGAAAGGAAAGAGAGAATGG No data
1173714890_1173714897 18 Left 1173714890 20:45194858-45194880 CCAGAGACCAATGAGAGTGGTCA No data
Right 1173714897 20:45194899-45194921 GGTAGAAAGGAAAGAGAGAATGG No data
1173714889_1173714897 19 Left 1173714889 20:45194857-45194879 CCCAGAGACCAATGAGAGTGGTC No data
Right 1173714897 20:45194899-45194921 GGTAGAAAGGAAAGAGAGAATGG No data
1173714891_1173714897 11 Left 1173714891 20:45194865-45194887 CCAATGAGAGTGGTCACCTATGT No data
Right 1173714897 20:45194899-45194921 GGTAGAAAGGAAAGAGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173714897 Original CRISPR GGTAGAAAGGAAAGAGAGAA TGG Intergenic
No off target data available for this crispr