ID: 1173718150

View in Genome Browser
Species Human (GRCh38)
Location 20:45229632-45229654
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173718150_1173718154 6 Left 1173718150 20:45229632-45229654 CCCAGAAGTTGTTTCACGTGGTT No data
Right 1173718154 20:45229661-45229683 TGGAAGTGAAAGAAAACAGCTGG No data
1173718150_1173718157 27 Left 1173718150 20:45229632-45229654 CCCAGAAGTTGTTTCACGTGGTT No data
Right 1173718157 20:45229682-45229704 GGTGCTTCCGGGTCAAGTTGAGG No data
1173718150_1173718156 16 Left 1173718150 20:45229632-45229654 CCCAGAAGTTGTTTCACGTGGTT No data
Right 1173718156 20:45229671-45229693 AGAAAACAGCTGGTGCTTCCGGG No data
1173718150_1173718155 15 Left 1173718150 20:45229632-45229654 CCCAGAAGTTGTTTCACGTGGTT No data
Right 1173718155 20:45229670-45229692 AAGAAAACAGCTGGTGCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173718150 Original CRISPR AACCACGTGAAACAACTTCT GGG (reversed) Intergenic