ID: 1173718151

View in Genome Browser
Species Human (GRCh38)
Location 20:45229633-45229655
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173718151_1173718154 5 Left 1173718151 20:45229633-45229655 CCAGAAGTTGTTTCACGTGGTTG 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1173718154 20:45229661-45229683 TGGAAGTGAAAGAAAACAGCTGG No data
1173718151_1173718156 15 Left 1173718151 20:45229633-45229655 CCAGAAGTTGTTTCACGTGGTTG 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1173718156 20:45229671-45229693 AGAAAACAGCTGGTGCTTCCGGG No data
1173718151_1173718157 26 Left 1173718151 20:45229633-45229655 CCAGAAGTTGTTTCACGTGGTTG 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1173718157 20:45229682-45229704 GGTGCTTCCGGGTCAAGTTGAGG No data
1173718151_1173718155 14 Left 1173718151 20:45229633-45229655 CCAGAAGTTGTTTCACGTGGTTG 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1173718155 20:45229670-45229692 AAGAAAACAGCTGGTGCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173718151 Original CRISPR CAACCACGTGAAACAACTTC TGG (reversed) Intergenic