ID: 1173718153

View in Genome Browser
Species Human (GRCh38)
Location 20:45229659-45229681
Sequence AGCTGTTTTCTTTCACTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173718153_1173718159 23 Left 1173718153 20:45229659-45229681 CCTGGAAGTGAAAGAAAACAGCT No data
Right 1173718159 20:45229705-45229727 CACCTCTGATCTCCAGCCCCCGG No data
1173718153_1173718157 0 Left 1173718153 20:45229659-45229681 CCTGGAAGTGAAAGAAAACAGCT No data
Right 1173718157 20:45229682-45229704 GGTGCTTCCGGGTCAAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173718153 Original CRISPR AGCTGTTTTCTTTCACTTCC AGG (reversed) Intergenic