ID: 1173718156

View in Genome Browser
Species Human (GRCh38)
Location 20:45229671-45229693
Sequence AGAAAACAGCTGGTGCTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173718149_1173718156 17 Left 1173718149 20:45229631-45229653 CCCCAGAAGTTGTTTCACGTGGT No data
Right 1173718156 20:45229671-45229693 AGAAAACAGCTGGTGCTTCCGGG No data
1173718151_1173718156 15 Left 1173718151 20:45229633-45229655 CCAGAAGTTGTTTCACGTGGTTG No data
Right 1173718156 20:45229671-45229693 AGAAAACAGCTGGTGCTTCCGGG No data
1173718150_1173718156 16 Left 1173718150 20:45229632-45229654 CCCAGAAGTTGTTTCACGTGGTT No data
Right 1173718156 20:45229671-45229693 AGAAAACAGCTGGTGCTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173718156 Original CRISPR AGAAAACAGCTGGTGCTTCC GGG Intergenic