ID: 1173718157

View in Genome Browser
Species Human (GRCh38)
Location 20:45229682-45229704
Sequence GGTGCTTCCGGGTCAAGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173718149_1173718157 28 Left 1173718149 20:45229631-45229653 CCCCAGAAGTTGTTTCACGTGGT No data
Right 1173718157 20:45229682-45229704 GGTGCTTCCGGGTCAAGTTGAGG No data
1173718150_1173718157 27 Left 1173718150 20:45229632-45229654 CCCAGAAGTTGTTTCACGTGGTT No data
Right 1173718157 20:45229682-45229704 GGTGCTTCCGGGTCAAGTTGAGG No data
1173718153_1173718157 0 Left 1173718153 20:45229659-45229681 CCTGGAAGTGAAAGAAAACAGCT No data
Right 1173718157 20:45229682-45229704 GGTGCTTCCGGGTCAAGTTGAGG No data
1173718151_1173718157 26 Left 1173718151 20:45229633-45229655 CCAGAAGTTGTTTCACGTGGTTG No data
Right 1173718157 20:45229682-45229704 GGTGCTTCCGGGTCAAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173718157 Original CRISPR GGTGCTTCCGGGTCAAGTTG AGG Intergenic