ID: 1173718159

View in Genome Browser
Species Human (GRCh38)
Location 20:45229705-45229727
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173718158_1173718159 -7 Left 1173718158 20:45229689-45229711 CCGGGTCAAGTTGAGGCACCTCT No data
Right 1173718159 20:45229705-45229727 CACCTCTGATCTCCAGCCCCCGG No data
1173718153_1173718159 23 Left 1173718153 20:45229659-45229681 CCTGGAAGTGAAAGAAAACAGCT No data
Right 1173718159 20:45229705-45229727 CACCTCTGATCTCCAGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173718159 Original CRISPR CACCTCTGATCTCCAGCCCC CGG Intergenic