ID: 1173718159 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:45229705-45229727 |
Sequence | CACCTCTGATCTCCAGCCCC CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1173718158_1173718159 | -7 | Left | 1173718158 | 20:45229689-45229711 | CCGGGTCAAGTTGAGGCACCTCT | No data | ||
Right | 1173718159 | 20:45229705-45229727 | CACCTCTGATCTCCAGCCCCCGG | No data | ||||
1173718153_1173718159 | 23 | Left | 1173718153 | 20:45229659-45229681 | CCTGGAAGTGAAAGAAAACAGCT | No data | ||
Right | 1173718159 | 20:45229705-45229727 | CACCTCTGATCTCCAGCCCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1173718159 | Original CRISPR | CACCTCTGATCTCCAGCCCC CGG | Intergenic | ||