ID: 1173720333

View in Genome Browser
Species Human (GRCh38)
Location 20:45252892-45252914
Sequence CTGTGCTTGGAGTAGGGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173720324_1173720333 28 Left 1173720324 20:45252841-45252863 CCTGAGACCTGGAGAACAGTTCT 0: 1
1: 0
2: 2
3: 20
4: 185
Right 1173720333 20:45252892-45252914 CTGTGCTTGGAGTAGGGTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 172
1173720325_1173720333 21 Left 1173720325 20:45252848-45252870 CCTGGAGAACAGTTCTCTTGAAG 0: 1
1: 1
2: 2
3: 12
4: 123
Right 1173720333 20:45252892-45252914 CTGTGCTTGGAGTAGGGTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 172
1173720323_1173720333 29 Left 1173720323 20:45252840-45252862 CCCTGAGACCTGGAGAACAGTTC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1173720333 20:45252892-45252914 CTGTGCTTGGAGTAGGGTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173720333 Original CRISPR CTGTGCTTGGAGTAGGGTTC AGG Intronic
900211917 1:1460415-1460437 CTGTGCTGGGAGCAGGGATGCGG - Intronic
900217573 1:1489923-1489945 CTGTGCTGGGAGCAGGGATGCGG - Intronic
900224679 1:1527392-1527414 CTGTGCTGGGAGCAGGGATTCGG - Intronic
900688700 1:3966198-3966220 CTGGGCTTGGGGTAGTGTCCTGG + Intergenic
901971861 1:12914536-12914558 CTGTGAGTGGAGAAGGGGTCAGG + Intronic
902013307 1:13287204-13287226 CTGTGAGTGGAGAAGGGGTCAGG - Intergenic
906105470 1:43289378-43289400 ATGTGCCAGGAGTAGGGGTCAGG + Intergenic
907276236 1:53318015-53318037 CTGTGCCTGGAGCTGGGTTCAGG - Intronic
910904534 1:92161046-92161068 CTGTGCCAGGGGTAGGATTCTGG + Intergenic
911669821 1:100594945-100594967 TTGTGCTAGGAGCAGGGATCTGG + Intergenic
915935352 1:160087400-160087422 GGGTGCTGGGAGTAGGGTTGTGG + Intronic
918248432 1:182680846-182680868 CTGTGTTTGGTGTAGGATGCTGG + Intronic
922232646 1:223700133-223700155 GTGTTCTGGGAGTAGGGTCCTGG - Intergenic
924075196 1:240326577-240326599 GTGTCCATGGAGTAGGATTCTGG + Intronic
1064481324 10:15743629-15743651 CAGTGCTTGGAGTGGTATTCTGG + Intergenic
1066496507 10:35947540-35947562 TTGTGCTTGGAGTTGGACTCTGG - Intergenic
1068471664 10:57473112-57473134 CTGTTCTTGGTCTGGGGTTCAGG + Intergenic
1069572482 10:69502734-69502756 CTGGGCCTGGAGAAGGGTTCTGG + Intronic
1070157796 10:73846957-73846979 CTGTTCTTGGATGAGGGCTCAGG - Intronic
1074274399 10:111987738-111987760 CTGTGCTTGGAGCTGGGCTCTGG - Intergenic
1075067569 10:119299724-119299746 CTGAGCCTGGAGTAGCGTGCTGG + Intronic
1075472982 10:122707174-122707196 CTGGACTTGTAGTAGGTTTCTGG + Intergenic
1076435590 10:130439021-130439043 CTGAGCCTGGAGAAGGGCTCAGG - Intergenic
1077451629 11:2651854-2651876 CTTTTCTTGAAGTAGTGTTCAGG + Intronic
1078339024 11:10485912-10485934 CTGTGCTGGGAGTGGGAGTCTGG + Intronic
1080387257 11:31817521-31817543 CTGAGCTGGGAGTAGGGGGCGGG - Intronic
1081551966 11:44121832-44121854 CTGTGCTGGGGGAAGGGTTATGG - Intronic
1083199039 11:61108640-61108662 CTGTGTTTTGGGTAGGATTCTGG - Intronic
1083451697 11:62750555-62750577 CTGTACTTGGGGTAGGGGTAGGG - Intronic
1083455754 11:62777718-62777740 CAGTGCTTGGTGTGGGGCTCAGG + Intronic
1083736923 11:64686654-64686676 CTTGGCTTGGAGTAGGGAGCTGG - Intronic
1089795010 11:120973258-120973280 CTGTGCTGACAGTAGAGTTCAGG + Intronic
1095680424 12:44968305-44968327 CTGTGCTTGGGTCAGGGTTATGG - Intergenic
1096185566 12:49578302-49578324 CTGTGTTTGCAGTAGGCTCCTGG + Intronic
1096438622 12:51618392-51618414 CTGTGCTTGGGGCACAGTTCTGG + Intronic
1104971931 12:132534685-132534707 CTGGGCTGGGTGGAGGGTTCAGG + Intronic
1105398812 13:20069297-20069319 CTGTACTAGGACTAGGGTTTGGG - Intronic
1105424426 13:20282688-20282710 CTGATCTTGGAGTAGGGGTTGGG + Intergenic
1106552110 13:30780980-30781002 CTGTGTTGGGAGTTGGGGTCTGG + Intergenic
1106659784 13:31786832-31786854 CTGTACTTGAAGAAGGTTTCAGG + Intronic
1107238568 13:38202852-38202874 CTGTGGTTTGAGTAAGGCTCTGG - Intergenic
1107635940 13:42392698-42392720 CTGTGTTTGGAGTAGAGATGAGG + Intergenic
1108211720 13:48146066-48146088 CTGTGCTGGGAGCAGGGTGGAGG - Intergenic
1109275604 13:60300359-60300381 CTGTGCTTTCAGTATGGGTCAGG + Intergenic
1112386312 13:98943165-98943187 CTGTGTTTGAAGTAAGGCTCTGG - Intronic
1121087760 14:91159639-91159661 CTGTGCCTAGAGTGGGGTTAGGG + Intronic
1121919737 14:97869467-97869489 CTGTGGTTGGAGTATGACTCTGG - Intergenic
1121973617 14:98382338-98382360 CTTTGTTTGAAGCAGGGTTCGGG + Intergenic
1126467730 15:48976116-48976138 CTGTGCCTGGAGAAGGGCTTTGG - Intergenic
1126646239 15:50877550-50877572 TTCTACTTGGAGTAGGGTGCTGG + Intergenic
1127017794 15:54708300-54708322 CTGATCTTGGAGCAGGGTTGGGG - Intergenic
1129153331 15:73702768-73702790 CTGGGCTTCGAGTAGGGAGCTGG - Exonic
1129153643 15:73704172-73704194 CTGGGCTTCGAGTAGGGAGCTGG - Exonic
1129521613 15:76189872-76189894 CTGTGCTGGGAGTAGGGCAGGGG - Intronic
1131046117 15:89317136-89317158 CTGTGGTTGAAGTAGGGGACAGG + Intronic
1131881932 15:96871164-96871186 CTGTGCTGGGAGTTGGGGTGGGG + Intergenic
1135475589 16:22771756-22771778 CTCTGCTTGGAGTGGGGGTGGGG - Intergenic
1136143093 16:28299638-28299660 CTGTTCTTGGAGTGGGGCTGAGG - Intronic
1136591049 16:31217938-31217960 ATGGGCTTGGAGTAGGGGGCAGG - Intronic
1137692146 16:50436131-50436153 ATGTGCCTGAAGTAAGGTTCTGG - Intergenic
1138240668 16:55424689-55424711 CTGTGCATGGAGGAGGGGTCAGG + Intronic
1138394457 16:56693132-56693154 CTGGGCTGAGCGTAGGGTTCAGG - Intronic
1139336272 16:66233829-66233851 CTGGGTTTGGAATAAGGTTCAGG - Intergenic
1139515621 16:67450879-67450901 CTGCCATTGGAATAGGGTTCGGG + Intronic
1140566513 16:76049069-76049091 CTGTGGTGGGAGGAGGGTGCAGG + Intergenic
1141250297 16:82350224-82350246 CTGTACTTGGAGCAGTGTTTTGG - Intergenic
1142250120 16:88987796-88987818 CTGTGCGTGGTGTATTGTTCTGG - Intergenic
1142409978 16:89911022-89911044 CTGTGCTGGGACTAGGGGCCCGG - Intronic
1142713468 17:1735886-1735908 CTGTGATGGGGGTGGGGTTCTGG + Intronic
1145388983 17:22440530-22440552 CTGTCCTGGGAGCAGGATTCTGG + Intergenic
1146459407 17:33033629-33033651 CTGAACTTGGAGCAGGGTTGGGG + Intronic
1146486739 17:33249222-33249244 CTGTGGGTGGAATAGGTTTCGGG + Intronic
1146725377 17:35151543-35151565 CTGAGCCAGGACTAGGGTTCAGG - Intronic
1149637952 17:58185398-58185420 GTGTGCAGGGAGGAGGGTTCTGG - Intergenic
1151395390 17:73819665-73819687 CTGATCTTGGAGCAGGGTTTGGG - Intergenic
1151788760 17:76290353-76290375 CTGGGCTTGGAGTTGGGAACAGG + Intronic
1152845958 17:82599908-82599930 CTGTGTTTGTGGTTGGGTTCAGG + Intronic
1160149938 18:76391265-76391287 TTGTGCTGGGATTAGGGTTGTGG - Intronic
1160653287 19:245908-245930 TTGGGGTTGGAGTAGGGTTAGGG - Intergenic
1162185304 19:8900245-8900267 CTGTGCTTGGTGTAGGATCAGGG + Intronic
1163176853 19:15570117-15570139 CTGTGCTGGGACTAGGGGACAGG + Intergenic
1165476419 19:36033206-36033228 GTGAGCTTGGAGAAGGGGTCCGG - Intronic
1166251613 19:41575568-41575590 CTGTCCTTGGTGAAGGTTTCAGG - Intronic
1167490439 19:49789928-49789950 CTGTGCTAGGAGCTGGGTTATGG + Intronic
1168338934 19:55612978-55613000 CTGTGGGTGGGGTAGGGTGCAGG + Intronic
925933502 2:8730989-8731011 CGGTGCTGGGAGTTCGGTTCAGG + Exonic
926310065 2:11668947-11668969 CTGGGCATGGTGTGGGGTTCGGG + Intronic
927226103 2:20767367-20767389 CTGATCTTGGAGTAGGGTTGGGG + Intronic
928561128 2:32486529-32486551 CTGTGCTTAGAAGAGGGTGCTGG + Intronic
931111265 2:59113942-59113964 CTGGCCTTGGAGGCGGGTTCAGG - Intergenic
933219301 2:79669969-79669991 CTGATCTTGGAGTGGGGTTGGGG - Intronic
933899102 2:86836415-86836437 CTGTGCTGGGACTAGGGGTGCGG - Intronic
935359842 2:102237958-102237980 CTTTGCTTGGAGTAGAATTCTGG - Intronic
935781451 2:106512811-106512833 CTGTGCTGGGACTAGGGGTGCGG + Intergenic
938229949 2:129649753-129649775 CTGTGCATGGTGTGGGGCTCTGG + Intergenic
938341751 2:130540562-130540584 CAGTGCTTGGAGGAAGATTCAGG - Intronic
938348078 2:130580147-130580169 CAGTGCTTGGAGGAAGATTCAGG + Intronic
939448027 2:142334768-142334790 CAGTGCTTTGAGTGGGGATCTGG + Intergenic
940068534 2:149657106-149657128 AAGTGCTTTGAGTAGGGCTCGGG - Intergenic
941659291 2:168178977-168178999 CTGAGCTGGGAGTCGGGGTCAGG + Intronic
943575257 2:189624628-189624650 CTGTGTTTGGAGTATTGTTTTGG + Intergenic
947200476 2:227610507-227610529 CTGTGATTGGAGTATTGTTAAGG + Exonic
947832224 2:233149671-233149693 CTGTGCTATCAGTGGGGTTCAGG - Intronic
1169660524 20:7973639-7973661 CTGTTCCTGGAGTAGGGGTAAGG - Intergenic
1170705018 20:18737337-18737359 CTGTGCTGGGAGTGGGAGTCAGG - Intronic
1171190107 20:23152716-23152738 CTGTGCTTGGAGAAGGTGGCTGG - Intergenic
1173720333 20:45252892-45252914 CTGTGCTTGGAGTAGGGTTCAGG + Intronic
1175689356 20:61054472-61054494 CTGTGCTTGGAGTGGACCTCAGG - Intergenic
1179478011 21:41660151-41660173 CTGTACCTGGAGCAGTGTTCTGG - Intergenic
1180214035 21:46313638-46313660 CTGTCCTGGGAGGAGGTTTCTGG + Intronic
1181648700 22:24247311-24247333 CTGTGCCTGGAGGAGGGAGCAGG + Intergenic
1182312761 22:29420943-29420965 CTGGGCTTAGAGAAGGGCTCAGG - Intronic
950805877 3:15602778-15602800 CTCTGCTTGGGGTGGGGTTGAGG - Intronic
950923298 3:16716458-16716480 CTGTGCTTGGGGTCTGCTTCAGG + Intergenic
953801968 3:46031362-46031384 CTGATCTTGGAGTAAGGTTGGGG + Intergenic
954497954 3:50983027-50983049 CAGATCTTGGAGCAGGGTTCGGG + Intronic
961426095 3:126849431-126849453 ATGTGTTTGGAGTAGGGTAGAGG + Intronic
962967193 3:140366000-140366022 CTGTGCGTGGAGAGGGTTTCTGG - Intronic
964384438 3:156132100-156132122 CTGTGCTTGAAACAGGGTTAGGG + Intronic
964397154 3:156257505-156257527 CTGTCCTCAGAGTAGGGCTCTGG - Intronic
964996693 3:162891392-162891414 CTGTGCCTGCAGTAGGGTACTGG - Intergenic
966301632 3:178485598-178485620 GTGTGCTTGGAGTTGGGGGCAGG - Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
967243200 3:187461685-187461707 TTGTACATGGAGTAGTGTTCAGG - Intergenic
967990037 3:195123848-195123870 GTGTGCTGGAATTAGGGTTCTGG - Intronic
969869640 4:10096591-10096613 CTGTTCTTGGCTTAGGGTACAGG - Intronic
971968662 4:33594157-33594179 CTTGGCTTAGAGTAGAGTTCAGG + Intergenic
973242226 4:47969331-47969353 CTTTACTAGGAGTGGGGTTCTGG - Intronic
974376514 4:61084668-61084690 CTGTGATTGGTGTCGGGTACTGG - Intergenic
976125031 4:81824890-81824912 ATGTGTTTGGAGGTGGGTTCTGG - Intronic
978136033 4:105261479-105261501 CTGTGCCAGGAGTAGGGTTAGGG - Intronic
978238419 4:106487848-106487870 CTGTGCTGGGAGTCCGCTTCAGG + Intergenic
980619407 4:135279004-135279026 CTGTGCTGGGTTTAGGTTTCAGG + Intergenic
983680613 4:170349237-170349259 CTGTGCTTTGAGGATGGTGCTGG + Intergenic
983784510 4:171715257-171715279 CTGACCTTGGAGCAGGGTTGGGG + Intergenic
985625242 5:982272-982294 CTGTGCTTGGGGTGGGGCTGAGG - Intergenic
985625262 5:982346-982368 CTGTGCTTGGGGTGGGGCTGAGG - Intergenic
986264855 5:6182626-6182648 CTGAGCTTGGCGTGGGGTGCAGG - Intergenic
986552913 5:8978711-8978733 CTCGGCTTGGAGTAGGGGCCGGG - Intergenic
988943046 5:36165308-36165330 TTATGCTTGGCTTAGGGTTCAGG + Intronic
989372011 5:40720787-40720809 CTGTGCTGGGAGTAGGATTCTGG - Intronic
989522759 5:42420928-42420950 CTGTGATTGGAGTATGTTTAAGG + Intergenic
990123475 5:52485088-52485110 CTGTGTTTGGGGTAGGTTTTTGG - Intergenic
991408011 5:66320400-66320422 CTCTACTGGGAGTAGGATTCTGG + Intergenic
996407010 5:123115330-123115352 CTTTCCTTGGAGAAGGATTCTGG - Intronic
999101469 5:149029109-149029131 CTGTGCTGGGAGTTGTGTCCTGG - Intronic
1000867031 5:166526520-166526542 GTGTGCTTGGAGAAGTGTCCTGG - Intergenic
1001109862 5:168886656-168886678 ATGAGATTGGAGTAGGGTGCAGG + Intronic
1002534036 5:179866342-179866364 CTGTGCTTGGTGCAGCGTTTCGG + Intronic
1003997403 6:11556684-11556706 CTCTGCTTGGAATTGGGTCCTGG + Intronic
1016042897 6:139450755-139450777 CTGTGATTTGAGAAGTGTTCAGG + Intergenic
1017332589 6:153217147-153217169 CTGTGCTGGAAGTAGGTTTTTGG - Intergenic
1018095923 6:160386959-160386981 CAGTGCTTGGAGCAGGGATCTGG - Intronic
1019065459 6:169292335-169292357 CTGTGCTTGGAGTGGGGACAAGG + Intergenic
1024329154 7:48139387-48139409 CTGTGCTTCATGTAGGGATCAGG + Intergenic
1028869922 7:95758451-95758473 CTGTGCTGGATGTAGTGTTCAGG + Intergenic
1031836382 7:126685565-126685587 CTGATCTTGGAGTAAGGTTGGGG + Intronic
1032402532 7:131633760-131633782 CAGTGCTTGGAGGAGGATGCTGG - Intergenic
1032453733 7:132056172-132056194 CTCTGCTTGGAGGATGCTTCAGG + Intergenic
1033212717 7:139472011-139472033 CTGTCCTGGGATTAGGGGTCAGG - Intronic
1034645177 7:152639971-152639993 CTGTGATTTTAGTAGGTTTCAGG - Intergenic
1037716752 8:21407568-21407590 CAGTGCTGGGAGTGGGGTTGGGG - Intergenic
1043925724 8:86034538-86034560 CAGAGCTTGGGGAAGGGTTCAGG - Intronic
1044171750 8:89061894-89061916 CTGTATTTGAACTAGGGTTCTGG - Intergenic
1045062685 8:98423049-98423071 CTGTGCTTGGAGCTGTGGTCTGG - Intronic
1047181553 8:122593584-122593606 CTGTGCTGGGAGAAGGTTTATGG - Intergenic
1047711666 8:127558841-127558863 CTGGGCTAGGAGAAAGGTTCTGG - Intergenic
1049245245 8:141558934-141558956 CTGTGCTGGGAGCAGGGCTGGGG + Intergenic
1049446470 8:142633741-142633763 CTGGGGTTGGAGTAGGTTTGGGG + Intergenic
1050176722 9:2876361-2876383 ATGTGCTTGGTGCAGTGTTCTGG + Intergenic
1051741234 9:20254376-20254398 CTGTGCTAGGAGCTGGGTACTGG + Intergenic
1054846182 9:69800983-69801005 GTGTGCTTGGAGGAAGGTTGTGG + Intergenic
1055700809 9:78944022-78944044 CTGAGATTGGAGCAGGGTTCTGG - Intergenic
1056062780 9:82901079-82901101 CCTTGCCAGGAGTAGGGTTCTGG - Intergenic
1057402588 9:94737915-94737937 CTAGGCTTGGACTGGGGTTCGGG + Intronic
1057491438 9:95522993-95523015 CTGTGTTTGGAGGGGGGCTCCGG + Intergenic
1057494197 9:95546882-95546904 CTGCACTTGGACTAGGGATCAGG - Intergenic
1059149742 9:111938728-111938750 CTGGGCTTGGAGTAAGGCTGAGG - Intergenic
1061922086 9:133787920-133787942 CGGTGCTTGGAGGAGGGCTGTGG - Intronic
1187418937 X:19118055-19118077 TTGTGCTTGCCATAGGGTTCTGG - Intronic
1190616602 X:52240127-52240149 CTGGGCATGGAGTATGGTTTCGG + Intergenic
1191925438 X:66304436-66304458 CTGTGCTTTGAGTTTGGTTCTGG - Intergenic
1193671277 X:84389527-84389549 CAAGGCTTGGAGTTGGGTTCTGG + Intronic
1195001840 X:100649869-100649891 CTGTGCATGCATTAGGGCTCAGG + Intronic
1197386205 X:125805743-125805765 CTATGCTTGGAGTGAGCTTCAGG + Intergenic