ID: 1173721977

View in Genome Browser
Species Human (GRCh38)
Location 20:45267483-45267505
Sequence CAATTTTACCATGTATGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173721977_1173721980 10 Left 1173721977 20:45267483-45267505 CCCATACATACATGGTAAAATTG No data
Right 1173721980 20:45267516-45267538 GGATGAATTCCCGAGCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173721977 Original CRISPR CAATTTTACCATGTATGTAT GGG (reversed) Intergenic
No off target data available for this crispr